Rev.	57	24	70	35	595	842	1
peru.	73	24	90	35	595	842	1
biol.	92	24	107	35	595	842	1
15(2):	109	24	130	35	595	842	1
097-	133	24	149	35	595	842	1
102	151	24	165	35	595	842	1
(Febrero	167	24	196	35	595	842	1
2009)	199	24	219	35	595	842	1
©	57	34	63	44	595	842	1
Facultad	65	34	92	44	595	842	1
de	94	34	102	44	595	842	1
Ciencias	104	34	131	44	595	842	1
Biológicas	133	34	168	44	595	842	1
UNMSM	170	34	200	44	595	842	1
Gene	246	30	266	42	595	842	1
expression	269	30	309	42	595	842	1
of	311	30	320	42	595	842	1
some	322	30	341	42	595	842	1
lignocellulolytic	343	30	413	42	595	842	1
enzymes	415	30	446	42	595	842	1
in	448	30	456	42	595	842	1
A	458	30	464	42	595	842	1
spergillus	464	33	498	41	595	842	1
niger	501	33	519	41	595	842	1
biofilms	521	30	553	42	595	842	1
Versión	436	30	464	42	595	842	1
Online	466	30	491	42	595	842	1
ISSN	493	30	512	42	595	842	1
1727-9933	515	30	554	42	595	842	1
Differential	175	60	237	77	595	842	1
gene	241	60	269	77	595	842	1
expression	272	60	335	77	595	842	1
of	339	60	350	77	595	842	1
some	353	60	385	77	595	842	1
lignocellulolytic	388	60	479	77	595	842	1
enzymes	482	60	533	77	595	842	1
in	536	60	547	77	595	842	1
Aspergillus	292	75	350	91	595	842	1
niger	354	75	380	91	595	842	1
biofilms	384	75	430	91	595	842	1
Expresión	170	101	223	116	595	842	1
diferencial	226	101	281	116	595	842	1
de	284	101	297	116	595	842	1
los	300	101	316	116	595	842	1
genes	319	101	351	116	595	842	1
de	354	101	367	116	595	842	1
algunas	370	101	411	116	595	842	1
enzimas	414	101	458	116	595	842	1
lignocelulolíticas	461	101	550	116	595	842	1
en	270	114	283	129	595	842	1
biopelículas	286	114	350	129	595	842	1
de	353	114	366	129	595	842	1
Aspergillus	369	114	422	128	595	842	1
niger	425	114	450	128	595	842	1
Gretty	187	138	216	152	595	842	1
K.	219	138	229	152	595	842	1
Villena	232	138	264	152	595	842	1
1	264	139	267	147	595	842	1
,	267	138	270	152	595	842	1
T.	273	138	281	152	595	842	1
Fujikawa	283	138	326	152	595	842	1
2	326	139	329	147	595	842	1
,	329	138	332	152	595	842	1
S.	334	138	344	152	595	842	1
Tsuyumu	347	138	390	152	595	842	1
2	390	139	394	147	595	842	1
and	395	138	413	152	595	842	1
Marcel	416	138	447	152	595	842	1
Gutiérrez-Correa	450	138	530	152	595	842	1
1	530	139	533	147	595	842	1
1	64	154	68	162	595	842	1
Laboratorio	70	154	100	162	595	842	1
de	103	154	109	162	595	842	1
Micología	112	154	137	162	595	842	1
y	140	154	143	162	595	842	1
Bio-	145	154	156	162	595	842	1
tecnología,	64	162	94	170	595	842	1
Universidad	97	162	129	170	595	842	1
Nacional	132	162	156	170	595	842	1
Agraria	64	169	85	177	595	842	1
La	88	169	95	177	595	842	1
Molina,	98	169	119	177	595	842	1
Lima,	122	169	137	177	595	842	1
Perú.	140	169	156	177	595	842	1
E-mail	64	176	82	184	595	842	1
Marcel	85	176	104	184	595	842	1
Gutiérrez-Correa:	106	176	156	184	595	842	1
mgclmb@lamolina.edu.pe	64	183	134	191	595	842	1
2	64	193	68	201	595	842	1
Institute	69	193	89	201	595	842	1
for	90	193	97	201	595	842	1
Molecular	98	193	124	201	595	842	1
Biology	125	193	145	201	595	842	1
and	146	193	156	201	595	842	1
Biotechnology,	64	201	102	208	595	842	1
Shizuoka	103	201	128	208	595	842	1
University,	129	201	156	208	595	842	1
Shizuoka,	64	208	91	216	595	842	1
Japan.	92	208	110	216	595	842	1
Abstract	181	157	222	171	595	842	1
Keywords:	167	257	208	268	595	842	1
Aspergillus	210	257	249	267	595	842	1
niger,	252	257	272	267	595	842	1
biofilms,	274	257	303	267	595	842	1
gene	305	257	323	267	595	842	1
expression,	325	257	366	267	595	842	1
cellulases,	369	257	406	267	595	842	1
xylanases.	408	257	446	267	595	842	1
Resumen	181	269	226	283	595	842	1
Palabras	167	369	201	380	595	842	1
clave:	203	369	225	380	595	842	1
Aspergillus	228	369	267	380	595	842	1
niger,	269	369	289	380	595	842	1
biopelículas,	291	369	336	380	595	842	1
expresión	338	369	373	380	595	842	1
génica,	375	369	401	380	595	842	1
celulasas,	403	369	438	380	595	842	1
xilanasas.	441	369	476	380	595	842	1
Introduction	71	389	129	403	595	842	1
Recently,	68	405	103	418	595	842	1
a	106	405	110	418	595	842	1
great	113	405	132	418	595	842	1
deal	135	405	150	418	595	842	1
of	153	405	161	418	595	842	1
attention	164	405	199	418	595	842	1
has	202	405	215	418	595	842	1
been	218	405	236	418	595	842	1
focused	239	405	268	418	595	842	1
on	271	405	281	418	595	842	1
the	284	405	296	418	595	842	1
use	57	417	69	430	595	842	1
of	72	417	79	430	595	842	1
lignocellulose	82	417	134	430	595	842	1
biomass	137	417	168	430	595	842	1
to	170	417	178	430	595	842	1
produce	181	417	212	430	595	842	1
bioethanol	215	417	256	430	595	842	1
and	259	417	273	430	595	842	1
other	276	417	296	430	595	842	1
useful	57	429	80	442	595	842	1
metabolites	84	429	128	442	595	842	1
by	132	429	141	442	595	842	1
means	145	429	170	442	595	842	1
of	174	429	182	442	595	842	1
its	185	429	194	442	595	842	1
hydrolysis	198	429	237	442	595	842	1
with	241	429	259	442	595	842	1
lignocel-	262	429	296	442	595	842	1
lulolytic	57	441	88	454	595	842	1
enzymes	91	441	124	454	595	842	1
produced	127	441	164	454	595	842	1
by	167	441	176	454	595	842	1
various	179	441	207	454	595	842	1
microorganisms	210	441	272	454	595	842	1
(Bhat	275	441	296	454	595	842	1
2000;	57	453	79	466	595	842	1
Gabel	81	453	103	466	595	842	1
&	105	453	113	466	595	842	1
Zacchi	115	453	141	466	595	842	1
2002;	142	453	165	466	595	842	1
Kim	166	453	183	466	595	842	1
&	185	453	193	466	595	842	1
Dale	195	453	213	466	595	842	1
2004).	215	453	240	466	595	842	1
Lignocellulose	242	453	296	466	595	842	1
biomass	57	465	88	478	595	842	1
consists	90	465	119	478	595	842	1
of	121	465	129	478	595	842	1
three	131	465	150	478	595	842	1
main	152	465	172	478	595	842	1
components:	174	465	224	478	595	842	1
cellulose,	226	465	261	478	595	842	1
hemicel-	263	465	296	478	595	842	1
lulose	57	477	79	490	595	842	1
and	82	477	97	490	595	842	1
lignin,	101	477	126	490	595	842	1
the	129	477	141	490	595	842	1
first	145	477	160	490	595	842	1
two	164	477	178	490	595	842	1
being	182	477	203	490	595	842	1
composed	207	477	246	490	595	842	1
of	249	477	257	490	595	842	1
chains	261	477	285	490	595	842	1
of	289	477	296	490	595	842	1
sugar	57	489	77	502	595	842	1
molecules	80	489	118	502	595	842	1
(Carpita	120	489	153	502	595	842	1
1996;	155	489	178	502	595	842	1
Fry	181	489	193	502	595	842	1
2004).	196	489	222	502	595	842	1
These	225	489	246	502	595	842	1
sugar	249	489	269	502	595	842	1
chains	272	489	296	502	595	842	1
can	57	501	70	514	595	842	1
be	74	501	83	514	595	842	1
hydrolyzed	87	501	129	514	595	842	1
to	133	501	141	514	595	842	1
produced	145	501	182	514	595	842	1
monomeric	186	501	231	514	595	842	1
sugars,	234	501	261	514	595	842	1
some	264	501	285	514	595	842	1
of	288	501	296	514	595	842	1
them	57	513	77	526	595	842	1
can	79	513	92	526	595	842	1
be	95	513	104	526	595	842	1
fermented	106	513	146	526	595	842	1
using	148	513	169	526	595	842	1
ordinary	171	513	204	526	595	842	1
producing	206	513	246	526	595	842	1
microorgan-	249	513	296	526	595	842	1
isms.	57	525	76	538	595	842	1
However,	78	525	115	538	595	842	1
the	117	525	129	538	595	842	1
cost	131	525	146	538	595	842	1
of	149	525	156	538	595	842	1
obtaining	158	525	195	538	595	842	1
sugars	198	525	221	538	595	842	1
from	223	525	242	538	595	842	1
lignocellulose	244	525	296	538	595	842	1
biomass	57	537	87	550	595	842	1
for	89	537	100	550	595	842	1
fermentation	102	537	152	550	595	842	1
is	154	537	159	550	595	842	1
still	161	537	175	550	595	842	1
high,	177	537	196	550	595	842	1
mostly	198	537	224	550	595	842	1
due	226	537	240	550	595	842	1
to	242	537	250	550	595	842	1
low	251	537	265	550	595	842	1
enzyme	267	537	296	550	595	842	1
yields	57	549	78	562	595	842	1
of	82	549	89	562	595	842	1
producing	93	549	132	562	595	842	1
microorganisms	136	549	197	562	595	842	1
(Gabel	200	549	226	562	595	842	1
&	230	549	238	562	595	842	1
Zacchi	241	549	267	562	595	842	1
2002).	271	549	296	562	595	842	1
Submerged	57	561	100	574	595	842	1
fermentation	103	561	153	574	595	842	1
(SF)	155	561	172	574	595	842	1
is	174	561	180	574	595	842	1
the	182	561	195	574	595	842	1
main	197	561	217	574	595	842	1
process	219	561	247	574	595	842	1
used	249	561	267	574	595	842	1
for	269	561	280	574	595	842	1
cel-	283	561	296	574	595	842	1
lulase	57	573	78	586	595	842	1
production	80	573	123	586	595	842	1
but	125	573	138	586	595	842	1
solid	140	573	158	586	595	842	1
state	160	573	178	586	595	842	1
fermentation	179	573	230	586	595	842	1
(SSF)	231	573	253	586	595	842	1
techniques	255	573	296	586	595	842	1
are	57	585	68	598	595	842	1
preferred	70	585	105	598	595	842	1
in	107	585	115	598	595	842	1
Asian	117	585	138	598	595	842	1
countries.	140	585	178	598	595	842	1
It	180	585	186	598	595	842	1
is	188	585	194	598	595	842	1
frequently	196	585	236	598	595	842	1
considered	238	585	279	598	595	842	1
that	281	585	296	598	595	842	1
enzyme	57	597	86	610	595	842	1
titers	89	597	108	610	595	842	1
attain	111	597	133	610	595	842	1
in	136	597	144	610	595	842	1
SSF	147	597	162	610	595	842	1
processes	165	597	200	610	595	842	1
are	203	597	214	610	595	842	1
higher	217	597	242	610	595	842	1
than	244	597	262	610	595	842	1
in	265	597	273	610	595	842	1
SF	276	597	286	610	595	842	1
as	289	597	296	610	595	842	1
recently	57	609	87	622	595	842	1
discussed	90	609	125	622	595	842	1
by	128	609	138	622	595	842	1
Viniegra-González	140	609	212	622	595	842	1
et	215	609	222	622	595	842	1
al.	225	609	234	622	595	842	1
(2003).	237	609	266	622	595	842	1
Also,	268	609	288	622	595	842	1
it	291	609	296	622	595	842	1
is	57	621	63	634	595	842	1
considered	66	621	107	634	595	842	1
that	110	621	126	634	595	842	1
SSF	129	621	144	634	595	842	1
resembles	148	621	185	634	595	842	1
the	188	621	200	634	595	842	1
natural	203	621	231	634	595	842	1
way	234	621	249	634	595	842	1
of	252	621	260	634	595	842	1
living	263	621	285	634	595	842	1
of	288	621	296	634	595	842	1
many	57	633	78	646	595	842	1
microorganisms,	80	633	144	646	595	842	1
particularly	146	633	190	646	595	842	1
fungi	193	633	213	646	595	842	1
that	215	633	230	646	595	842	1
grow	233	633	252	646	595	842	1
attached	254	633	286	646	595	842	1
to	288	633	296	646	595	842	1
the	57	645	69	658	595	842	1
surface	71	645	98	658	595	842	1
of	100	645	107	658	595	842	1
solid	109	645	127	658	595	842	1
particles	129	645	161	658	595	842	1
in	163	645	171	658	595	842	1
the	173	645	185	658	595	842	1
absence	187	645	217	658	595	842	1
of	219	645	226	658	595	842	1
free	228	645	242	658	595	842	1
flowing	244	645	273	658	595	842	1
water	275	645	296	658	595	842	1
(Hölker	57	657	87	670	595	842	1
et	90	657	97	670	595	842	1
al.	99	657	108	670	595	842	1
2004).	111	657	136	670	595	842	1
Other	68	675	91	688	595	842	1
fermentation	93	675	142	688	595	842	1
techniques	143	675	184	688	595	842	1
like	185	675	199	688	595	842	1
fungal	200	675	224	688	595	842	1
immobilization	226	675	284	688	595	842	1
are	285	675	296	688	595	842	1
also	57	687	71	700	595	842	1
being	73	687	95	700	595	842	1
considered	97	687	138	700	595	842	1
for	140	687	151	700	595	842	1
production	153	687	196	700	595	842	1
of	198	687	206	700	595	842	1
enzymes	208	687	240	700	595	842	1
and	242	687	257	700	595	842	1
other	259	687	279	700	595	842	1
me-	281	687	296	700	595	842	1
tabolites	57	699	89	712	595	842	1
(Iqbal	91	699	114	712	595	842	1
&	116	699	124	712	595	842	1
Saeed	126	699	148	712	595	842	1
2005,	149	699	172	712	595	842	1
Wu	174	699	187	712	595	842	1
et	189	699	196	712	595	842	1
al.	198	699	207	712	595	842	1
2005;	209	699	232	712	595	842	1
Yang	233	699	252	712	595	842	1
et	254	699	261	712	595	842	1
al.	263	699	272	712	595	842	1
2005;	274	699	296	712	595	842	1
Skowronek	57	711	100	724	595	842	1
&	103	711	111	724	595	842	1
Fiedurek	115	711	148	724	595	842	1
2006).	152	711	177	724	595	842	1
Surface	181	711	209	724	595	842	1
binding	212	711	242	724	595	842	1
is	246	711	251	724	595	842	1
commonly	255	711	296	724	595	842	1
used	57	723	74	736	595	842	1
to	77	723	84	736	595	842	1
immobilize	87	723	130	736	595	842	1
cells	133	723	149	736	595	842	1
and	151	723	166	736	595	842	1
involves	168	723	199	736	595	842	1
cell	201	723	214	736	595	842	1
attachment	217	723	260	736	595	842	1
by	262	723	272	736	595	842	1
either	274	723	296	736	595	842	1
chemical	57	735	91	748	595	842	1
bonding	94	735	126	748	595	842	1
or	130	735	138	748	595	842	1
cell	141	735	154	748	595	842	1
adhesion.	157	735	194	748	595	842	1
The	197	735	211	748	595	842	1
latter	214	735	234	748	595	842	1
is	237	735	243	748	595	842	1
a	246	735	250	748	595	842	1
simple	254	735	279	748	595	842	1
and	282	735	296	748	595	842	1
inexpensive	57	747	101	760	595	842	1
procedure	104	747	142	760	595	842	1
in	145	747	152	760	595	842	1
which	155	747	178	760	595	842	1
cells	181	747	197	760	595	842	1
actively	199	747	228	760	595	842	1
participate	230	747	271	760	595	842	1
in	274	747	282	760	595	842	1
the	284	747	296	760	595	842	1
attachment	57	759	100	772	595	842	1
process;	102	759	132	772	595	842	1
thus,	134	759	153	772	595	842	1
a	155	759	159	772	595	842	1
distinction	160	759	202	772	595	842	1
should	204	759	229	772	595	842	1
be	231	759	240	772	595	842	1
made	242	759	263	772	595	842	1
between	265	759	296	772	595	842	1
this	57	771	71	784	595	842	1
type	74	771	91	784	595	842	1
of	95	771	102	784	595	842	1
immobilization	106	771	165	784	595	842	1
and	169	771	184	784	595	842	1
the	187	771	199	784	595	842	1
other	203	771	224	784	595	842	1
methods.	227	771	263	784	595	842	1
Natural	267	771	296	784	595	842	1
Rev.	57	798	70	810	595	842	1
peru.	73	798	90	810	595	842	1
biol.	92	798	107	810	595	842	1
15(2):	109	798	131	810	595	842	1
097-	133	798	149	810	595	842	1
102	151	798	165	810	595	842	1
(February	167	798	201	810	595	842	1
2009)	203	798	224	810	595	842	1
attached	313	391	346	404	595	842	1
cells	348	391	364	404	595	842	1
develop	367	391	397	404	595	842	1
an	399	391	408	404	595	842	1
active	411	391	433	404	595	842	1
biofilm	435	391	463	404	595	842	1
structure	466	391	500	404	595	842	1
with	503	391	520	404	595	842	1
changes	523	391	553	404	595	842	1
in	313	403	321	416	595	842	1
their	324	403	342	416	595	842	1
physiology	344	403	386	416	595	842	1
due	388	403	403	416	595	842	1
to	405	403	413	416	595	842	1
gene	460	403	478	416	595	842	1
expression	480	403	520	416	595	842	1
(Ghigo,	523	403	553	416	595	842	1
2003).	313	415	339	428	595	842	1
Filamentous	342	415	390	428	595	842	1
fungi	393	415	413	428	595	842	1
are	416	415	427	428	595	842	1
naturally	430	415	465	428	595	842	1
adapted	468	415	498	428	595	842	1
to	501	415	509	428	595	842	1
growth	512	415	540	428	595	842	1
on	543	415	553	428	595	842	1
surfaces	313	427	343	440	595	842	1
and	346	427	360	440	595	842	1
in	363	427	371	440	595	842	1
these	374	427	393	440	595	842	1
conditions	396	427	437	440	595	842	1
they	440	427	457	440	595	842	1
show	460	427	479	440	595	842	1
a	482	427	486	440	595	842	1
particular	489	427	526	440	595	842	1
physi-	529	427	553	440	595	842	1
ological	313	439	343	452	595	842	1
behavior	345	439	379	452	595	842	1
which	381	439	404	452	595	842	1
is	407	439	413	452	595	842	1
different	415	439	448	452	595	842	1
from	450	439	469	452	595	842	1
that	472	439	487	452	595	842	1
in	489	439	497	452	595	842	1
SF;	500	439	512	452	595	842	1
thus,	515	439	534	452	595	842	1
they	536	439	553	452	595	842	1
can	313	451	326	464	595	842	1
be	328	451	337	464	595	842	1
considered	339	451	379	464	595	842	1
as	381	451	388	464	595	842	1
biofilm	390	451	418	464	595	842	1
forming	420	451	451	464	595	842	1
organisms	452	451	491	464	595	842	1
according	492	451	529	464	595	842	1
to	531	451	539	464	595	842	1
the	541	451	553	464	595	842	1
above	313	463	335	476	595	842	1
concept.	337	463	370	476	595	842	1
Both	372	463	391	476	595	842	1
SSF	393	463	408	476	595	842	1
and	410	463	425	476	595	842	1
fungal	427	463	451	476	595	842	1
biofilm	453	463	481	476	595	842	1
fermentation	483	463	533	476	595	842	1
(BF)	535	463	553	476	595	842	1
depend	313	475	342	488	595	842	1
on	345	475	355	488	595	842	1
surface	358	475	384	488	595	842	1
adhesion	387	475	421	488	595	842	1
and	424	475	439	488	595	842	1
a	442	475	446	488	595	842	1
new	449	475	464	488	595	842	1
fermentation	467	475	518	488	595	842	1
category	520	475	553	488	595	842	1
named	313	487	339	500	595	842	1
surface	342	487	369	500	595	842	1
adhesion	372	487	406	500	595	842	1
fermentation	409	487	459	500	595	842	1
(SAF)	462	487	485	500	595	842	1
was	488	487	502	500	595	842	1
proposed	505	487	540	500	595	842	1
by	543	487	553	500	595	842	1
Gutiérrez-Correa	313	499	379	512	595	842	1
and	382	499	396	512	595	842	1
Villena	398	499	426	512	595	842	1
(2003).	428	499	457	512	595	842	1
There	325	517	347	530	595	842	1
are	350	517	362	530	595	842	1
few	366	517	379	530	595	842	1
reports	383	517	410	530	595	842	1
on	414	517	424	530	595	842	1
cellulase	428	517	460	530	595	842	1
production	464	517	508	530	595	842	1
by	511	517	521	530	595	842	1
biofilm	525	517	553	530	595	842	1
cultures	313	529	343	542	595	842	1
of	346	529	354	542	595	842	1
Aspergillus	356	529	396	541	595	842	1
niger.	398	529	419	541	595	842	1
In	422	529	430	542	595	842	1
previous	433	529	465	542	595	842	1
studies,	468	529	497	542	595	842	1
it	499	529	505	542	595	842	1
was	508	529	521	542	595	842	1
showed	524	529	553	542	595	842	1
that	313	541	329	554	595	842	1
A.	332	541	340	553	595	842	1
niger	344	541	362	553	595	842	1
biofilms	366	541	397	554	595	842	1
developed	400	541	439	554	595	842	1
on	442	541	452	554	595	842	1
polyester	456	541	490	554	595	842	1
cloth	493	541	513	554	595	842	1
produced	516	541	553	554	595	842	1
50—70%	313	553	352	566	595	842	1
more	356	553	376	566	595	842	1
cellulase	379	553	411	566	595	842	1
activity	415	553	443	566	595	842	1
than	447	553	465	566	595	842	1
freely	468	553	489	566	595	842	1
suspended	493	553	533	566	595	842	1
my-	537	553	553	566	595	842	1
celial	313	565	333	578	595	842	1
cultures	337	565	367	578	595	842	1
(Villena	371	565	401	578	595	842	1
&	405	565	413	578	595	842	1
Gutierrez-Correa	417	565	483	578	595	842	1
2003;	487	565	510	578	595	842	1
Villena	513	565	541	578	595	842	1
&	544	565	553	578	595	842	1
Gutierrez-Correa,	313	577	382	590	595	842	1
2006;	385	577	407	590	595	842	1
Villena	410	577	437	590	595	842	1
&	440	577	449	590	595	842	1
Gutierrez-Correa,	452	577	520	590	595	842	1
2007a).	523	577	553	590	595	842	1
Other	313	589	337	602	595	842	1
authors	339	589	367	602	595	842	1
have	370	589	387	602	595	842	1
also	389	589	404	602	595	842	1
demonstrated	406	589	458	602	595	842	1
that	461	589	476	602	595	842	1
other	478	589	498	602	595	842	1
species	500	589	526	602	595	842	1
like	528	589	542	602	595	842	1
A.	544	589	553	601	595	842	1
fumigatus	313	601	350	613	595	842	1
form	351	601	370	614	595	842	1
biofilms	372	601	403	614	595	842	1
and	405	601	420	614	595	842	1
that	422	601	437	614	595	842	1
this	439	601	453	614	595	842	1
condition	455	601	492	614	595	842	1
is	494	601	500	614	595	842	1
most	502	601	521	614	595	842	1
relevant	523	601	553	614	595	842	1
in	313	613	321	626	595	842	1
lung	325	613	342	626	595	842	1
mycoses	346	613	377	626	595	842	1
(Beauvais	381	613	417	626	595	842	1
et	421	613	428	626	595	842	1
al.,	432	613	443	626	595	842	1
2007;	447	613	470	626	595	842	1
Mowat	473	613	501	626	595	842	1
et	504	613	511	626	595	842	1
al.,	515	613	527	626	595	842	1
2007;	530	613	553	626	595	842	1
Mowat	313	625	341	638	595	842	1
et	343	625	350	638	595	842	1
al.,	352	625	364	638	595	842	1
2008a).	366	625	396	638	595	842	1
Although	398	625	434	638	595	842	1
Chandrasekar	437	625	490	638	595	842	1
and	492	625	507	638	595	842	1
Manavathu	509	625	553	638	595	842	1
(2008)	313	637	340	650	595	842	1
discussed	343	637	379	650	595	842	1
the	382	637	394	650	595	842	1
potential	398	637	432	650	595	842	1
ability	435	637	459	650	595	842	1
of	463	637	471	650	595	842	1
A.	474	637	482	649	595	842	1
fumigatus	486	637	522	649	595	842	1
growth	525	637	553	650	595	842	1
on	313	649	323	662	595	842	1
surfaces	325	649	355	662	595	842	1
to	357	649	365	662	595	842	1
satisfy	367	649	391	662	595	842	1
key	393	649	406	662	595	842	1
biofilm	408	649	436	662	595	842	1
characteristics,	438	649	494	662	595	842	1
all	497	649	506	662	595	842	1
the	508	649	520	662	595	842	1
research	522	649	553	662	595	842	1
evidence	313	661	347	674	595	842	1
recently	350	661	381	674	595	842	1
available	385	661	418	674	595	842	1
strongly	422	661	453	674	595	842	1
supports	457	661	490	674	595	842	1
that	494	661	510	674	595	842	1
Aspergillus	513	661	553	673	595	842	1
species	313	673	339	686	595	842	1
actually	343	673	373	686	595	842	1
forms	377	673	399	686	595	842	1
biofilms	403	673	434	686	595	842	1
when	438	673	459	686	595	842	1
grown	463	673	487	686	595	842	1
on	491	673	501	686	595	842	1
surfaces	505	673	535	686	595	842	1
and	539	673	553	686	595	842	1
that	313	685	329	698	595	842	1
some	332	685	352	698	595	842	1
genes	356	685	376	698	595	842	1
are	380	685	391	698	595	842	1
differentially	395	685	443	698	595	842	1
expressed	447	685	483	698	595	842	1
in	486	685	494	698	595	842	1
this	498	685	512	698	595	842	1
condition	515	685	553	698	595	842	1
(Mowat	313	697	344	710	595	842	1
et	346	697	353	710	595	842	1
al.,	356	697	367	710	595	842	1
2008b).	370	697	401	710	595	842	1
Fungi	325	714	347	727	595	842	1
can	350	714	363	727	595	842	1
be	366	714	375	727	595	842	1
considered	378	714	420	727	595	842	1
as	423	714	430	727	595	842	1
regular	433	714	459	727	595	842	1
biofilm	462	714	490	727	595	842	1
forming	493	714	525	727	595	842	1
organ-	528	714	553	727	595	842	1
isms	313	726	330	739	595	842	1
with	333	726	351	739	595	842	1
two	354	726	369	739	595	842	1
inherent	372	726	405	739	595	842	1
and	408	726	422	739	595	842	1
fundamental	426	726	475	739	595	842	1
processes:	478	726	515	739	595	842	1
adhesion	519	726	553	739	595	842	1
and	313	738	328	751	595	842	1
subsequent	332	738	375	751	595	842	1
differential	379	738	421	751	595	842	1
gene	425	738	443	751	595	842	1
expression	447	738	487	751	595	842	1
to	491	738	499	751	595	842	1
develop	503	738	533	751	595	842	1
new	537	738	553	751	595	842	1
and	313	750	328	763	595	842	1
distinct	332	750	362	763	595	842	1
phenotypes	366	750	411	763	595	842	1
different	415	750	448	763	595	842	1
from	452	750	471	763	595	842	1
those	475	750	496	763	595	842	1
of	500	750	508	763	595	842	1
free	512	750	526	763	595	842	1
living	530	750	553	763	595	842	1
conditions	313	762	354	775	595	842	1
(Wimpenny	357	762	405	775	595	842	1
et	408	762	415	775	595	842	1
al.	419	762	428	775	595	842	1
2000;	431	762	454	775	595	842	1
Gutiérrez-Correa	457	762	523	775	595	842	1
&	526	762	535	775	595	842	1
Vil-	538	762	553	775	595	842	1
lena,	313	774	331	787	595	842	1
2003).	334	774	360	787	595	842	1
From	363	774	384	787	595	842	1
this	387	774	401	787	595	842	1
point	404	774	425	787	595	842	1
of	428	774	436	787	595	842	1
view,	439	774	458	787	595	842	1
the	461	774	473	787	595	842	1
study	476	774	497	787	595	842	1
of	500	774	508	787	595	842	1
differential	511	774	553	787	595	842	1
97	541	800	552	814	595	842	1
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	565	302	577	544	595	842	1
Presentado:	57	345	89	353	595	842	1
09/06/2008	91	345	121	353	595	842	1
Aceptado:	57	352	84	360	595	842	1
19/08/2008	85	352	115	360	595	842	1
Publicado	57	360	83	367	595	842	1
online:	85	360	102	367	595	842	1
26/02/2009	104	360	134	367	595	842	1
Villena	42	31	71	42	595	842	2
et	74	31	82	42	595	842	2
al.	84	31	94	42	595	842	2
gene	42	55	60	67	595	842	2
expression	62	55	101	67	595	842	2
of	103	55	111	67	595	842	2
biofilms	113	55	144	67	595	842	2
developed	146	55	184	67	595	842	2
by	186	55	195	67	595	842	2
filamentous	197	55	242	67	595	842	2
fungi	244	55	264	67	595	842	2
may	266	55	282	67	595	842	2
be	42	67	51	79	595	842	2
the	55	67	67	79	595	842	2
starting	70	67	99	79	595	842	2
line	102	67	117	79	595	842	2
of	120	67	128	79	595	842	2
an	131	67	140	79	595	842	2
analysis	143	67	173	79	595	842	2
of	176	67	184	79	595	842	2
differential	187	67	229	79	595	842	2
physiological	232	67	282	79	595	842	2
behavior	42	79	76	91	595	842	2
as	78	79	86	91	595	842	2
compared	88	79	127	91	595	842	2
to	129	79	137	91	595	842	2
submerged	140	79	182	91	595	842	2
cultures,	185	79	217	91	595	842	2
which	220	79	243	91	595	842	2
is	246	79	252	91	595	842	2
needed	255	79	282	91	595	842	2
to	42	91	50	103	595	842	2
establish	53	91	85	103	595	842	2
the	87	91	100	103	595	842	2
role	102	91	116	103	595	842	2
of	118	91	126	103	595	842	2
cell	128	91	141	103	595	842	2
adhesion	143	91	178	103	595	842	2
and	180	91	194	103	595	842	2
the	196	91	208	103	595	842	2
growth	211	91	238	103	595	842	2
on	240	91	250	103	595	842	2
surfaces	252	91	282	103	595	842	2
on	42	103	53	115	595	842	2
the	55	103	67	115	595	842	2
productivity	69	103	116	115	595	842	2
of	119	103	126	115	595	842	2
submerged	128	103	170	115	595	842	2
industrial	173	103	209	115	595	842	2
processes.	211	103	249	115	595	842	2
The	251	103	265	115	595	842	2
aim	268	103	282	115	595	842	2
of	42	115	50	127	595	842	2
the	53	115	65	127	595	842	2
present	68	115	96	127	595	842	2
work	99	115	118	127	595	842	2
was	121	115	135	127	595	842	2
to	138	115	146	127	595	842	2
study	149	115	170	127	595	842	2
the	173	115	185	127	595	842	2
gene	188	115	206	127	595	842	2
expression	208	115	248	127	595	842	2
patterns	251	115	282	127	595	842	2
of	42	127	50	139	595	842	2
some	54	127	74	139	595	842	2
lignocellulolytic	78	127	139	139	595	842	2
enzymes	143	127	176	139	595	842	2
of	179	127	187	139	595	842	2
Aspergillus	191	127	230	139	595	842	2
niger	234	127	252	139	595	842	2
during	256	127	282	139	595	842	2
biofilm	42	139	70	151	595	842	2
formation	73	139	112	151	595	842	2
on	114	139	124	151	595	842	2
polyester.	127	139	163	151	595	842	2
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	19	299	30	541	595	842	2
Materials	57	156	100	169	595	842	2
and	103	156	121	169	595	842	2
methods	123	156	165	169	595	842	2
Microorganism.	54	171	119	183	595	842	2
Aspergillus	121	171	160	184	595	842	2
niger	163	171	181	184	595	842	2
ATCC	183	171	209	184	595	842	2
10864	211	171	236	184	595	842	2
maintained	238	171	282	184	595	842	2
on	42	183	53	196	595	842	2
potato	55	183	80	196	595	842	2
dextrose	83	183	115	196	595	842	2
agar	118	183	134	196	595	842	2
slants	137	183	158	196	595	842	2
was	161	183	174	196	595	842	2
used	177	183	195	196	595	842	2
throughout	198	183	242	196	595	842	2
the	245	183	257	196	595	842	2
study.	260	183	282	196	595	842	2
Spores	42	195	67	208	595	842	2
were	70	195	87	208	595	842	2
washed	90	195	118	208	595	842	2
from	120	195	139	208	595	842	2
5-day	141	195	163	208	595	842	2
agar-slant	165	195	202	208	595	842	2
cultures	204	195	235	208	595	842	2
with	237	195	254	208	595	842	2
10	256	195	266	208	595	842	2
mL	269	195	282	208	595	842	2
of	42	207	50	220	595	842	2
0,1%	53	207	74	220	595	842	2
Tween	77	207	102	220	595	842	2
80	105	207	115	220	595	842	2
solution,	118	207	152	220	595	842	2
counted	155	207	186	220	595	842	2
in	190	207	197	220	595	842	2
a	200	207	204	220	595	842	2
Neubauer	208	207	246	220	595	842	2
chamber	249	207	282	220	595	842	2
and	42	219	57	232	595	842	2
diluted	59	219	86	232	595	842	2
to	88	219	96	232	595	842	2
give	98	219	113	232	595	842	2
1	115	219	120	232	595	842	2
x	122	219	126	232	595	842	2
10	128	219	138	232	595	842	2
6	138	220	141	227	595	842	2
spores/mL.	143	219	185	232	595	842	2
This	187	219	204	232	595	842	2
suspension	205	219	247	232	595	842	2
was	249	219	263	232	595	842	2
used	265	219	282	232	595	842	2
as	43	231	50	244	595	842	2
inoculum	52	231	90	244	595	842	2
at	92	231	99	244	595	842	2
a	102	231	106	244	595	842	2
proportion	109	231	151	244	595	842	2
of	154	231	161	244	595	842	2
3%	164	231	177	244	595	842	2
(v/v).	180	231	201	244	595	842	2
Culture	204	231	233	244	595	842	2
medium	236	231	268	244	595	842	2
for	271	231	282	244	595	842	2
both	43	243	60	256	595	842	2
SF	62	243	72	256	595	842	2
and	74	243	88	256	595	842	2
BF	90	243	102	256	595	842	2
was	103	243	117	256	595	842	2
described	119	243	155	256	595	842	2
elsewhere	157	243	193	256	595	842	2
(Villena	195	243	225	256	595	842	2
and	227	243	241	256	595	842	2
Gutiérrez-	243	243	282	256	595	842	2
Correa,	43	255	71	268	595	842	2
2006).	74	255	100	268	595	842	2
Submerged	54	273	100	285	595	842	2
and	103	273	118	285	595	842	2
Biofilm	121	273	151	285	595	842	2
Fermentation.	154	273	212	285	595	842	2
For	215	273	228	286	595	842	2
both	231	273	249	286	595	842	2
types	252	273	271	286	595	842	2
of	274	273	282	286	595	842	2
fermentation	43	285	93	298	595	842	2
systems	95	285	124	298	595	842	2
250	127	285	142	298	595	842	2
mL	144	285	157	298	595	842	2
flasks	160	285	180	298	595	842	2
containing	183	285	224	298	595	842	2
70	227	285	237	298	595	842	2
mL	239	285	253	298	595	842	2
culture	255	285	282	298	595	842	2
medium	43	297	75	310	595	842	2
were	78	297	96	310	595	842	2
used.	100	297	119	310	595	842	2
For	123	297	136	310	595	842	2
BF	139	297	151	310	595	842	2
each	154	297	171	310	595	842	2
flask	175	297	192	310	595	842	2
containing	196	297	237	310	595	842	2
a	240	297	244	310	595	842	2
polyester	248	297	282	310	595	842	2
100/1cloth	43	309	85	322	595	842	2
square	87	309	112	322	595	842	2
in	114	309	122	322	595	842	2
70	124	309	134	322	595	842	2
mL	136	309	149	322	595	842	2
distilled	151	309	181	322	595	842	2
water	183	309	204	322	595	842	2
was	206	309	220	322	595	842	2
inoculated	222	309	263	322	595	842	2
with	265	309	282	322	595	842	2
2,1	43	321	55	334	595	842	2
mL	58	321	71	334	595	842	2
spore	74	321	94	334	595	842	2
suspension,	97	321	142	334	595	842	2
incubated	144	321	183	334	595	842	2
for	185	321	196	334	595	842	2
15	199	321	209	334	595	842	2
min	212	321	228	334	595	842	2
at	231	321	238	334	595	842	2
28	241	321	251	334	595	842	2
ºC	254	321	264	334	595	842	2
in	267	321	275	334	595	842	2
a	278	321	282	334	595	842	2
shaker	43	333	67	346	595	842	2
bath	69	333	86	346	595	842	2
at	88	333	95	346	595	842	2
175	97	333	112	346	595	842	2
rpm	114	333	131	346	595	842	2
to	133	333	141	346	595	842	2
allow	143	333	163	346	595	842	2
the	165	333	177	346	595	842	2
attachment	179	333	223	346	595	842	2
of	225	333	232	346	595	842	2
spores.	234	333	261	346	595	842	2
After	263	333	282	346	595	842	2
this	43	345	56	358	595	842	2
contact	58	345	87	358	595	842	2
period,	88	345	116	358	595	842	2
the	118	345	130	358	595	842	2
squares	132	345	159	358	595	842	2
were	161	345	179	358	595	842	2
washed	181	345	209	358	595	842	2
twice	211	345	231	358	595	842	2
with	233	345	250	358	595	842	2
distilled	252	345	282	358	595	842	2
water	43	357	63	370	595	842	2
under	66	357	89	370	595	842	2
agitation	92	357	126	370	595	842	2
at	129	357	136	370	595	842	2
175	139	357	154	370	595	842	2
rpm	157	357	173	370	595	842	2
for	176	357	187	370	595	842	2
15	190	357	200	370	595	842	2
min;	203	357	221	370	595	842	2
then	224	357	242	370	595	842	2
they	245	357	261	370	595	842	2
were	264	357	282	370	595	842	2
transferred	43	369	83	382	595	842	2
to	84	369	92	382	595	842	2
flasks	94	369	114	382	595	842	2
containing	116	369	156	382	595	842	2
70	158	369	168	382	595	842	2
mL	169	369	182	382	595	842	2
of	184	369	192	382	595	842	2
the	193	369	205	382	595	842	2
culture	207	369	233	382	595	842	2
medium.	235	369	269	382	595	842	2
All	271	369	282	382	595	842	2
flasks	43	381	63	394	595	842	2
were	66	381	83	394	595	842	2
incubated	86	381	124	394	595	842	2
at	126	381	133	394	595	842	2
28	136	381	146	394	595	842	2
ºC	148	381	159	394	595	842	2
in	162	381	170	394	595	842	2
a	172	381	176	394	595	842	2
shaker	179	381	203	394	595	842	2
bath	206	381	223	394	595	842	2
at	225	381	233	394	595	842	2
175	235	381	250	394	595	842	2
rpm.	253	381	271	394	595	842	2
RT-PCR.	54	399	91	411	595	842	2
At	93	399	102	411	595	842	2
each	105	399	122	411	595	842	2
time	124	399	142	411	595	842	2
point	144	399	165	411	595	842	2
100	167	399	182	411	595	842	2
mg	184	399	197	411	595	842	2
of	199	399	207	411	595	842	2
either	209	399	231	411	595	842	2
mycelial	233	399	265	411	595	842	2
pel-	267	399	282	411	595	842	2
lets	43	411	55	423	595	842	2
(SF)	58	411	75	423	595	842	2
or	78	411	86	423	595	842	2
biofilm	89	411	117	423	595	842	2
(BF)	120	411	138	423	595	842	2
were	141	411	159	423	595	842	2
ground	162	411	190	423	595	842	2
in	193	411	201	423	595	842	2
liquid	204	411	226	423	595	842	2
nitrogen,	229	411	265	423	595	842	2
and	268	411	282	423	595	842	2
total	43	423	60	435	595	842	2
RNA	63	423	84	435	595	842	2
in	87	423	95	435	595	842	2
the	98	423	110	435	595	842	2
samples	113	423	143	435	595	842	2
was	146	423	160	435	595	842	2
isolated	163	423	192	435	595	842	2
by	196	423	205	435	595	842	2
RNeasy	208	423	238	435	595	842	2
plant	241	423	261	435	595	842	2
mini	264	423	282	435	595	842	2
kit	299	55	310	67	595	842	2
(QIAGEN,	312	55	357	67	595	842	2
Tokyo,	359	55	386	67	595	842	2
Japan)	389	55	413	67	595	842	2
according	416	55	454	67	595	842	2
to	456	55	464	67	595	842	2
the	467	55	479	67	595	842	2
manufacturer's	482	55	539	67	595	842	2
instructions.	299	67	347	79	595	842	2
Total	350	67	370	79	595	842	2
RNA	373	67	393	79	595	842	2
was	396	67	410	79	595	842	2
used	413	67	430	79	595	842	2
for	434	67	445	79	595	842	2
reverse	448	67	474	79	595	842	2
transcription	477	67	526	79	595	842	2
by	529	67	539	79	595	842	2
Omniscript	299	79	344	91	595	842	2
RT	347	79	360	91	595	842	2
kit	363	79	374	91	595	842	2
(QIAGEN,	377	79	421	91	595	842	2
Tokyo,	424	79	451	91	595	842	2
Japan).	455	79	482	91	595	842	2
Each	485	79	504	91	595	842	2
reaction	508	79	539	91	595	842	2
tube	299	91	316	103	595	842	2
contained	319	91	357	103	595	842	2
12	360	91	370	103	595	842	2
µL	372	91	383	103	595	842	2
total	386	91	403	103	595	842	2
RNA	406	91	427	103	595	842	2
(2	429	91	437	103	595	842	2
µg),	440	91	455	103	595	842	2
2	458	91	463	103	595	842	2
µL	466	91	477	103	595	842	2
10X	479	91	496	103	595	842	2
RT	498	91	511	103	595	842	2
buffer,	514	91	539	103	595	842	2
2	299	103	304	115	595	842	2
µL	306	103	317	115	595	842	2
dNTP	319	103	344	115	595	842	2
mix	347	103	361	115	595	842	2
(5	364	103	372	115	595	842	2
mM	374	103	391	115	595	842	2
each),	394	103	417	115	595	842	2
2	419	103	424	115	595	842	2
µL	426	103	437	115	595	842	2
oligo	439	103	458	115	595	842	2
dT-primer	461	103	501	115	595	842	2
(10	503	103	516	115	595	842	2
µM),	519	103	539	115	595	842	2
1	299	115	304	127	595	842	2
µL	306	115	317	127	595	842	2
RNase	319	115	344	127	595	842	2
inhibitor	346	115	380	127	595	842	2
(10U/mL)	382	115	422	127	595	842	2
and	424	115	439	127	595	842	2
1	441	115	446	127	595	842	2
µL	448	115	458	127	595	842	2
reverse	460	115	486	127	595	842	2
transcriptase;	488	115	539	127	595	842	2
the	299	127	311	139	595	842	2
reaction	314	127	345	139	595	842	2
was	347	127	361	139	595	842	2
conducted	364	127	404	139	595	842	2
at	407	127	414	139	595	842	2
37	416	127	426	139	595	842	2
ºC	429	127	439	139	595	842	2
for	442	127	453	139	595	842	2
1	456	127	461	139	595	842	2
h.	463	127	471	139	595	842	2
PCR.	310	145	332	157	595	842	2
Synthesized	334	144	378	157	595	842	2
cDNA	379	144	405	157	595	842	2
was	406	144	420	157	595	842	2
used	422	144	439	157	595	842	2
for	440	144	451	157	595	842	2
PCR.	453	144	474	157	595	842	2
Primer	476	144	501	157	595	842	2
combina-	503	144	539	157	595	842	2
tions	299	156	318	169	595	842	2
for	320	156	331	169	595	842	2
the	334	156	346	169	595	842	2
amplification	348	156	399	169	595	842	2
of	402	156	409	169	595	842	2
some	412	156	432	169	595	842	2
lignocellulolytic	434	156	495	169	595	842	2
genes	498	156	519	169	595	842	2
were	521	156	539	169	595	842	2
derived	299	168	327	181	595	842	2
from	330	168	349	181	595	842	2
the	352	168	364	181	595	842	2
A.	367	168	375	181	595	842	2
niger	378	168	396	181	595	842	2
data	399	168	415	181	595	842	2
bank	418	168	437	181	595	842	2
at	440	168	447	181	595	842	2
the	450	168	462	181	595	842	2
National	465	168	499	181	595	842	2
Center	501	168	528	181	595	842	2
of	531	168	539	181	595	842	2
Biotechnology	299	180	354	193	595	842	2
Information	356	180	402	193	595	842	2
(www.ncbi.nlm.nih.gov;	404	180	496	193	595	842	2
as	497	180	505	193	595	842	2
available	506	180	539	193	595	842	2
in	299	192	307	205	595	842	2
2005)	310	192	333	205	595	842	2
and	336	192	351	205	595	842	2
are	354	192	365	205	595	842	2
presented	368	192	405	205	595	842	2
in	408	192	416	205	595	842	2
Table	419	192	440	205	595	842	2
1.	443	192	451	205	595	842	2
The	454	192	469	205	595	842	2
semi-quantitative	472	192	539	205	595	842	2
PCR	299	204	318	217	595	842	2
was	322	204	336	217	595	842	2
carried	340	204	368	217	595	842	2
out	372	204	385	217	595	842	2
for	389	204	400	217	595	842	2
the	404	204	417	217	595	842	2
exponential	421	204	467	217	595	842	2
phase	471	204	493	217	595	842	2
after	497	204	515	217	595	842	2
cycle	519	204	539	217	595	842	2
optimization.	299	216	351	229	595	842	2
Each	354	216	373	229	595	842	2
tube	376	216	393	229	595	842	2
contained	396	216	434	229	595	842	2
1,5	436	216	449	229	595	842	2
µL	452	216	462	229	595	842	2
10X	465	216	482	229	595	842	2
buffer;	484	216	510	229	595	842	2
1,2	513	216	525	229	595	842	2
µL	528	216	539	229	595	842	2
dNTP	299	228	324	241	595	842	2
mix	326	228	341	241	595	842	2
(5	344	228	352	241	595	842	2
mM	354	228	371	241	595	842	2
each);	374	228	397	241	595	842	2
0,3	399	228	411	241	595	842	2
µL	414	228	425	241	595	842	2
forward	427	228	457	241	595	842	2
primer	460	228	486	241	595	842	2
(10	488	228	501	241	595	842	2
µM);	504	228	524	241	595	842	2
0,3	526	228	539	241	595	842	2
µL	299	240	310	253	595	842	2
reverse	312	240	338	253	595	842	2
primer	340	240	366	253	595	842	2
(10	369	240	382	253	595	842	2
µM);	384	240	404	253	595	842	2
0,08	406	240	424	253	595	842	2
µL	426	240	437	253	595	842	2
Gen	439	240	456	253	595	842	2
Taq	457	240	472	253	595	842	2
polymerase	474	240	517	253	595	842	2
(5U/	520	240	539	253	595	842	2
µL;	299	252	312	265	595	842	2
WaKo);	316	252	346	265	595	842	2
1,5	350	252	362	265	595	842	2
µL	366	252	377	265	595	842	2
cDNA	380	252	406	265	595	842	2
sample	410	252	437	265	595	842	2
and	441	252	455	265	595	842	2
10,12	459	252	481	265	595	842	2
µL	485	252	496	265	595	842	2
ultra-pure	500	252	538	265	595	842	2
water.	299	264	322	277	595	842	2
Reaction	325	264	359	277	595	842	2
process	362	264	390	277	595	842	2
was	393	264	407	277	595	842	2
as	410	264	418	277	595	842	2
follows:	421	264	451	277	595	842	2
cycle	454	264	473	277	595	842	2
1	476	264	481	277	595	842	2
(1x)	484	264	500	277	595	842	2
95	503	264	513	277	595	842	2
ºC	516	264	527	277	595	842	2
(4	530	264	539	277	595	842	2
min);	299	276	320	289	595	842	2
cycle	323	276	342	289	595	842	2
2	345	276	350	289	595	842	2
(40x),	353	276	376	289	595	842	2
step	379	276	395	289	595	842	2
1	398	276	403	289	595	842	2
95	406	276	416	289	595	842	2
ºC	419	276	429	289	595	842	2
(30	432	276	446	289	595	842	2
s),	449	276	457	289	595	842	2
step	460	276	476	289	595	842	2
2	479	276	484	289	595	842	2
55	487	276	497	289	595	842	2
ºC	500	276	511	289	595	842	2
(30	514	276	527	289	595	842	2
s),	530	276	539	289	595	842	2
step	299	288	314	301	595	842	2
3	318	288	323	301	595	842	2
72	326	288	336	301	595	842	2
ºC	339	288	350	301	595	842	2
(30	353	288	366	301	595	842	2
s);	370	288	378	301	595	842	2
cycle	382	288	400	301	595	842	2
3	404	288	409	301	595	842	2
(1x)	412	288	428	301	595	842	2
72	431	288	441	301	595	842	2
ºC	444	288	455	301	595	842	2
(5	458	288	466	301	595	842	2
min);	469	288	491	301	595	842	2
and	494	288	508	301	595	842	2
cycle	512	288	530	301	595	842	2
4	534	288	539	301	595	842	2
(1x)	299	300	315	313	595	842	2
4	318	300	323	313	595	842	2
ºC	326	300	337	313	595	842	2
until	340	300	359	313	595	842	2
use.	362	300	376	313	595	842	2
PCR	380	300	399	313	595	842	2
products	402	300	435	313	595	842	2
were	439	300	456	313	595	842	2
separated	459	300	495	313	595	842	2
by	498	300	508	313	595	842	2
agarose	511	300	539	313	595	842	2
electrophoresis	299	312	356	325	595	842	2
containing	358	312	400	325	595	842	2
trace	402	312	420	325	595	842	2
amounts	422	312	456	325	595	842	2
of	458	312	466	325	595	842	2
ethidium	468	312	504	325	595	842	2
bromide	506	312	539	325	595	842	2
and	299	324	313	337	595	842	2
visualized	315	324	352	337	595	842	2
with	354	324	371	337	595	842	2
UV	373	324	387	337	595	842	2
transilluminator	389	324	451	337	595	842	2
and	453	324	468	337	595	842	2
analized	469	324	500	337	595	842	2
in	502	324	510	337	595	842	2
a	512	324	516	337	595	842	2
Fluor	518	324	539	337	595	842	2
S	299	336	304	349	595	842	2
Multimager	306	336	352	349	595	842	2
(BIORAD).	355	336	401	349	595	842	2
Assays.	310	354	339	366	595	842	2
Cellulase	342	354	376	367	595	842	2
as	379	354	386	367	595	842	2
filter	389	354	407	367	595	842	2
paper	409	354	431	367	595	842	2
activity	434	354	462	367	595	842	2
(FPA)	464	354	487	367	595	842	2
and	490	354	504	367	595	842	2
xylanase	507	354	539	367	595	842	2
(XYL)	299	366	323	379	595	842	2
were	325	366	342	379	595	842	2
measured	344	366	380	379	595	842	2
from	382	366	401	379	595	842	2
the	402	366	415	379	595	842	2
fermentation	416	366	466	379	595	842	2
broth	468	366	489	379	595	842	2
as	491	366	498	379	595	842	2
previously	500	366	538	379	595	842	2
reported	299	378	332	391	595	842	2
(Dueñas	335	378	368	391	595	842	2
et	372	378	379	391	595	842	2
al.,	382	378	394	391	595	842	2
1995).	398	378	423	391	595	842	2
One	427	378	444	391	595	842	2
international	448	378	498	391	595	842	2
unit	501	378	517	391	595	842	2
(IU)	521	378	538	391	595	842	2
of	299	390	307	403	595	842	2
enzyme	310	390	339	403	595	842	2
activity	342	390	370	403	595	842	2
was	373	390	387	403	595	842	2
defined	390	390	419	403	595	842	2
as	422	390	429	403	595	842	2
the	432	390	444	403	595	842	2
amount	447	390	477	403	595	842	2
of	480	390	488	403	595	842	2
enzyme	491	390	520	403	595	842	2
that	523	390	539	403	595	842	2
releases	299	402	327	415	595	842	2
1	330	402	335	415	595	842	2
µmol	338	402	358	415	595	842	2
product	361	402	391	415	595	842	2
per	394	402	407	415	595	842	2
min	410	402	425	415	595	842	2
(glucose	428	402	459	415	595	842	2
equivalents	462	402	505	415	595	842	2
for	508	402	519	415	595	842	2
FPA	522	402	539	415	595	842	2
and	299	414	313	427	595	842	2
xylose	316	414	339	427	595	842	2
equivalents	342	414	385	427	595	842	2
for	387	414	398	427	595	842	2
XYL).	401	414	424	427	595	842	2
Table	43	444	63	455	595	842	2
1.	65	444	72	455	595	842	2
Primer	74	444	98	455	595	842	2
sequences	100	444	138	455	595	842	2
for	141	444	150	455	595	842	2
some	152	444	172	455	595	842	2
lignocellulolytic	174	444	227	455	595	842	2
enzyme	230	444	258	455	595	842	2
genes	260	444	282	455	595	842	2
of	284	444	290	455	595	842	2
Aspergillus	293	444	332	455	595	842	2
niger.	334	444	354	455	595	842	2
Genes	65	460	88	471	595	842	2
Forward	170	460	200	471	595	842	2
Reverse	357	460	386	471	595	842	2
cbhA	65	488	82	499	595	842	2
5'	170	488	176	499	595	842	2
tgaaggtcgagttgatggga	178	488	254	499	595	842	2
3'	258	488	265	499	595	842	2
5'	357	488	363	499	595	842	2
gacaccggaatccaagatgac	365	488	446	499	595	842	2
3'	450	488	456	499	595	842	2
cbhB	65	502	81	513	595	842	2
5'	170	502	176	513	595	842	2
gcaagtgtacccactcacaca	178	502	255	513	595	842	2
3'	257	502	264	513	595	842	2
5'	357	502	363	513	595	842	2
aagcggttgtacgtgcaaga	365	502	441	513	595	842	2
3'	443	502	449	513	595	842	2
exo	65	516	76	527	595	842	2
5'	170	516	176	527	595	842	2
tgtgctctcgttgccctcttg	180	516	250	527	595	842	2
3'	252	516	259	527	595	842	2
5'	357	516	363	527	595	842	2
agtgcattggcgccttcctc	365	516	436	527	595	842	2
3'	440	516	446	527	595	842	2
eglA	65	545	80	555	595	842	2
5'	170	545	176	555	595	842	2
tccccgtgtcacttgctatg	180	545	249	555	595	842	2
3'	251	545	257	555	595	842	2
5'	357	545	363	555	595	842	2
cagttcatagtcgccgctaga	365	545	442	555	595	842	2
3'	444	545	450	555	595	842	2
eglB	65	559	79	570	595	842	2
5'	170	559	176	570	595	842	2
atctcaaccaagcagccatt	178	559	250	570	595	842	2
3'	252	559	258	570	595	842	2
5'	357	559	363	570	595	842	2
ccaggatatccagcataccc	365	559	439	570	595	842	2
3'	441	559	447	570	595	842	2
eglC	65	573	80	584	595	842	2
5'	170	573	176	584	595	842	2
tggtgttaccggtctcttcaaaaccga	178	573	274	584	595	842	2
3'	276	573	282	584	595	842	2
5'	357	573	363	584	595	842	2
gctataccagggatagacttacactgcgaa	365	573	477	584	595	842	2
3'	479	573	485	584	595	842	2
eng1	65	587	80	598	595	842	2
5'	170	587	176	598	595	842	2
cgacttggtcagtttgatacc	178	587	252	598	595	842	2
3'	254	587	260	598	595	842	2
5'	357	587	363	598	595	842	2
atacccgtgtaagcagttcc	365	587	437	598	595	842	2
3'	439	587	445	598	595	842	2
bgl1	65	615	79	626	595	842	2
5'	170	616	176	626	595	842	2
tacggcatgaaccactacac	178	616	252	626	595	842	2
3'	254	616	260	626	595	842	2
5'	357	616	363	626	595	842	2
agcatccctttgcaggtatc	365	616	436	626	595	842	2
3'	438	616	444	626	595	842	2
bgl2	65	630	79	640	595	842	2
5'	170	630	176	640	595	842	2
agctacactctgaacagctg	178	630	251	640	595	842	2
3'	253	630	259	640	595	842	2
5'	357	630	363	640	595	842	2
aagcactcgtttgagatgg	365	630	435	640	595	842	2
3'	437	630	444	640	595	842	2
5'	170	658	176	669	595	842	2
agcggatcatgggaaaccga	178	658	256	669	595	842	2
3'	258	658	265	669	595	842	2
5'	357	658	363	669	595	842	2
gtgtaatctatgaatgcctatagcgggtaa	365	658	474	669	595	842	2
3'	476	658	482	669	595	842	2
5'	170	686	176	697	595	842	2
ctcccagcaagccaatgacc	178	686	252	697	595	842	2
3'	254	686	260	697	595	842	2
5'	357	686	363	697	595	842	2
gacggcaaatgcagatcgcgct	365	686	449	697	595	842	2
3'	451	686	457	697	595	842	2
5'	170	715	176	725	595	842	2
acgacatcctccgaccctcatc	178	715	256	725	595	842	2
3'	258	715	264	725	595	842	2
5'	357	715	363	725	595	842	2
tccaagatttctgccgctgcttc	365	715	444	725	595	842	2
3'	446	715	452	725	595	842	2
5'	170	743	176	754	595	842	2
agtgcattggcgccttcctc	178	743	248	754	595	842	2
3'	250	743	257	754	595	842	2
5'	357	743	363	754	595	842	2
tgtgtctcgttgccctcttg	365	743	432	754	595	842	2
3'	434	743	440	754	595	842	2
5'	170	771	176	782	595	842	2
gaaccatctacacctaccccaaca	178	771	265	782	595	842	2
3'	267	771	273	782	595	842	2
5'	357	771	363	782	595	842	2
tgctgccgaccaattgacct	365	771	437	782	595	842	2
3'	439	771	445	782	595	842	2
Cellobiohydrolases	65	474	133	485	595	842	2
Endoglucanases	65	531	122	541	595	842	2
β-glucosidases	65	601	117	612	595	842	2
Xylanases	65	644	100	655	595	842	2
xyn	65	658	77	669	595	842	2
B	79	658	84	669	595	842	2
Cellulase	65	672	97	683	595	842	2
represor	99	672	129	683	595	842	2
creA	65	686	80	697	595	842	2
Cellulase	65	701	97	711	595	842	2
activator	99	701	131	711	595	842	2
xlnR	65	715	81	725	595	842	2
Hydrofobin	65	729	107	740	595	842	2
hydrophobin	65	743	105	754	595	842	2
Elongation	65	757	104	768	595	842	2
factor	106	757	126	768	595	842	2
EF	65	771	74	782	595	842	2
98	42	800	54	814	595	842	2
Rev.	376	798	390	810	595	842	2
peru.	392	798	409	810	595	842	2
biol.	411	798	426	810	595	842	2
15(2):	428	798	450	810	595	842	2
097-	452	798	468	810	595	842	2
102	470	798	484	810	595	842	2
(Febrero	486	798	515	810	595	842	2
2009)	518	798	539	810	595	842	2
Gene	246	30	266	42	595	842	3
expression	269	30	309	42	595	842	3
of	311	30	320	42	595	842	3
some	322	30	341	42	595	842	3
lignocellulolytic	343	30	413	42	595	842	3
enzymes	415	30	446	42	595	842	3
in	448	30	456	42	595	842	3
A	458	30	464	42	595	842	3
spergillus	464	33	498	41	595	842	3
niger	501	33	519	41	595	842	3
biofilms	521	30	553	42	595	842	3
Figure	57	252	81	263	595	842	3
1.	83	252	90	263	595	842	3
Differential	92	252	130	263	595	842	3
expression	131	252	170	263	595	842	3
analysis	172	252	201	263	595	842	3
of	203	252	209	263	595	842	3
genes	211	252	233	263	595	842	3
coding	235	252	258	263	595	842	3
for	260	252	270	263	595	842	3
some	272	252	291	263	595	842	3
lignocellulolytic	293	252	346	263	595	842	3
enzymes	348	252	380	263	595	842	3
(see	382	252	398	263	595	842	3
Table	399	252	418	263	595	842	3
1)	420	252	427	263	595	842	3
in	429	252	435	263	595	842	3
Aspergillus	437	252	476	263	595	842	3
niger	478	252	496	263	595	842	3
grown	498	252	520	263	595	842	3
in	522	252	528	263	595	842	3
biofilm	530	252	553	263	595	842	3
fermentation	57	262	101	272	595	842	3
(BF)	103	262	119	272	595	842	3
and	121	262	134	272	595	842	3
submerged	137	262	177	272	595	842	3
fermentation	179	262	223	272	595	842	3
(BF).	226	262	243	272	595	842	3
Arrows	245	262	270	272	595	842	3
show	272	262	291	272	595	842	3
additional	293	262	327	272	595	842	3
transcript	330	262	363	272	595	842	3
bands.	365	262	389	272	595	842	3
Figure	68	381	92	393	595	842	3
1	94	381	99	393	595	842	3
shows	101	381	124	393	595	842	3
differentially	126	381	174	393	595	842	3
expressed	176	381	212	393	595	842	3
genes	214	381	234	393	595	842	3
in	236	381	244	393	595	842	3
both	246	381	264	393	595	842	3
fermen-	266	381	296	393	595	842	3
tation	57	393	80	405	595	842	3
systems.	82	393	113	405	595	842	3
At	115	393	125	405	595	842	3
24	127	393	137	405	595	842	3
h	139	393	144	405	595	842	3
growth	146	393	174	405	595	842	3
biofilms	176	393	207	405	595	842	3
differentially	209	393	258	405	595	842	3
expressed	260	393	296	405	595	842	3
eng1,	57	405	77	417	595	842	3
eglC	78	405	95	417	595	842	3
and	97	405	111	417	595	842	3
xylB	113	405	129	417	595	842	3
while	131	405	152	417	595	842	3
at	154	405	161	417	595	842	3
48	163	405	173	417	595	842	3
h	175	405	180	417	595	842	3
growth	182	405	209	417	595	842	3
biofilm	211	405	239	417	595	842	3
genes	241	405	262	417	595	842	3
eglA	264	405	280	417	595	842	3
and	282	405	296	417	595	842	3
eglC	57	417	73	429	595	842	3
showed	75	417	103	429	595	842	3
additional	105	417	143	429	595	842	3
bands.	145	417	170	429	595	842	3
At	172	417	181	429	595	842	3
72	183	417	193	429	595	842	3
and	195	417	209	429	595	842	3
96	211	417	221	429	595	842	3
h	222	417	227	429	595	842	3
growth	229	417	256	429	595	842	3
when	258	417	279	429	595	842	3
bio-	281	417	296	429	595	842	3
film	57	429	72	441	595	842	3
cellulolytic	74	429	114	441	595	842	3
enzyme	116	429	145	441	595	842	3
activity	146	429	174	441	595	842	3
was	175	429	189	441	595	842	3
maximal	191	429	223	441	595	842	3
and	225	429	239	441	595	842	3
higher	241	429	265	441	595	842	3
than	266	429	283	441	595	842	3
SF,	285	429	296	441	595	842	3
exoglucanase	57	441	106	453	595	842	3
gene	109	441	127	453	595	842	3
(exo)	129	441	147	453	595	842	3
was	150	441	163	453	595	842	3
differentially	166	441	215	453	595	842	3
expressed	217	441	253	453	595	842	3
while	256	441	276	453	595	842	3
eng1	279	441	296	453	595	842	3
and	57	453	71	465	595	842	3
xynB	73	453	92	465	595	842	3
showed	94	453	123	465	595	842	3
also	125	453	139	465	595	842	3
additional	141	453	180	465	595	842	3
bands.	182	453	208	465	595	842	3
Although	210	453	246	465	595	842	3
several	248	453	273	465	595	842	3
genes	275	453	296	465	595	842	3
were	57	465	74	477	595	842	3
expressed	77	465	113	477	595	842	3
in	116	465	124	477	595	842	3
both	127	465	145	477	595	842	3
fermentation	148	465	198	477	595	842	3
systems,	201	465	233	477	595	842	3
their	236	465	254	477	595	842	3
expression	257	465	296	477	595	842	3
levels	57	477	77	489	595	842	3
were	79	477	97	489	595	842	3
different	99	477	132	489	595	842	3
as	134	477	141	489	595	842	3
shown	143	477	168	489	595	842	3
in	170	477	178	489	595	842	3
Figure	180	477	204	489	595	842	3
2.	207	477	214	489	595	842	3
At	216	477	225	489	595	842	3
all	227	477	236	489	595	842	3
sampling	238	477	273	489	595	842	3
times	276	477	296	489	595	842	3
transcription	57	489	106	501	595	842	3
of	109	489	116	501	595	842	3
either	119	489	141	501	595	842	3
cellulase	143	489	175	501	595	842	3
or	177	489	186	501	595	842	3
xylanase	188	489	220	501	595	842	3
genes	222	489	243	501	595	842	3
was	245	489	259	501	595	842	3
higher	261	489	286	501	595	842	3
in	288	489	296	501	595	842	3
BF.	57	501	69	513	595	842	3
In	72	501	81	513	595	842	3
SF	84	501	94	513	595	842	3
very	97	501	113	513	595	842	3
low	116	501	130	513	595	842	3
transcription	132	501	182	513	595	842	3
level	185	501	202	513	595	842	3
was	205	501	219	513	595	842	3
found	222	501	245	513	595	842	3
for	248	501	259	513	595	842	3
bgl2	262	501	278	513	595	842	3
(24,	281	501	296	513	595	842	3
72,	57	513	69	525	595	842	3
and	72	513	87	525	595	842	3
96	90	513	100	525	595	842	3
h	103	513	108	525	595	842	3
growth),	111	513	144	525	595	842	3
eglB	147	513	162	525	595	842	3
(24	165	513	178	525	595	842	3
h	181	513	186	525	595	842	3
growth),	189	513	222	525	595	842	3
eglC	225	513	242	525	595	842	3
(24	245	513	258	525	595	842	3
and	261	513	275	525	595	842	3
96	278	513	288	525	595	842	3
h	291	513	296	525	595	842	3
growth),	57	525	90	537	595	842	3
and	93	525	107	537	595	842	3
xynB	110	525	129	537	595	842	3
(48	132	525	145	537	595	842	3
h	148	525	153	537	595	842	3
growth).	156	525	189	537	595	842	3
At	192	525	201	537	595	842	3
96	204	525	214	537	595	842	3
h	217	525	223	537	595	842	3
and	226	525	240	537	595	842	3
120	243	525	258	537	595	842	3
h	261	525	266	537	595	842	3
growth	269	525	296	537	595	842	3
expression	57	537	96	549	595	842	3
level	99	537	116	549	595	842	3
of	119	537	126	549	595	842	3
eglA	129	537	145	549	595	842	3
and	147	537	162	549	595	842	3
eglB	164	537	180	549	595	842	3
was	182	537	196	549	595	842	3
not	199	537	212	549	595	842	3
notoriously	215	537	259	549	595	842	3
higher	261	537	286	549	595	842	3
in	288	537	296	549	595	842	3
BF	57	549	68	561	595	842	3
unlike	71	549	95	561	595	842	3
eglC,	99	549	117	561	595	842	3
cbhB	120	549	139	561	595	842	3
and	142	549	157	561	595	842	3
bgl2	160	549	176	561	595	842	3
genes.	179	549	202	561	595	842	3
Considering	205	549	253	561	595	842	3
that	256	549	271	561	595	842	3
maxi-	274	549	296	561	595	842	3
mal	57	561	71	573	595	842	3
cellulase	74	561	106	573	595	842	3
and	109	561	123	573	595	842	3
xylanase	126	561	158	573	595	842	3
occurred	161	561	194	573	595	842	3
at	197	561	204	573	595	842	3
72	207	561	217	573	595	842	3
h	220	561	225	573	595	842	3
and	228	561	243	573	595	842	3
96	245	561	255	573	595	842	3
h	258	561	264	573	595	842	3
growth,	266	561	296	573	595	842	3
respectively,	313	288	359	301	595	842	3
it	362	288	368	301	595	842	3
is	370	288	376	301	595	842	3
possible	379	288	409	301	595	842	3
that	412	288	428	301	595	842	3
differentially	430	288	479	301	595	842	3
expressed	482	288	518	301	595	842	3
Exo	521	288	536	301	595	842	3
and	538	288	553	301	595	842	3
XynB	313	300	335	313	595	842	3
enzymes	337	300	369	313	595	842	3
in	371	300	379	313	595	842	3
those	381	300	401	313	595	842	3
moments	403	300	439	313	595	842	3
may	441	300	457	313	595	842	3
be	459	300	468	313	595	842	3
the	470	300	482	313	595	842	3
main	484	300	504	313	595	842	3
contributors	505	300	553	313	595	842	3
to	313	312	321	325	595	842	3
lignocellulolytic	338	312	400	325	595	842	3
activity.	402	312	432	325	595	842	3
It	325	330	331	342	595	842	3
has	334	330	346	342	595	842	3
been	349	330	367	342	595	842	3
stated	370	330	393	342	595	842	3
that	396	330	411	342	595	842	3
in	414	330	422	342	595	842	3
fungi	425	330	445	342	595	842	3
differential	448	330	490	342	595	842	3
gene	493	330	510	342	595	842	3
expression	513	330	553	342	595	842	3
is	313	342	319	354	595	842	3
related	322	342	348	354	595	842	3
to	350	342	358	354	595	842	3
pH,	361	342	377	354	595	842	3
nutrient	379	342	411	354	595	842	3
type	414	342	430	354	595	842	3
and	433	342	447	354	595	842	3
availability,	450	342	493	354	595	842	3
thermal	496	342	526	354	595	842	3
shock,	528	342	553	354	595	842	3
and	313	354	328	366	595	842	3
culture	329	354	356	366	595	842	3
conditions	358	354	399	366	595	842	3
(Denison	401	354	437	366	595	842	3
2000;	439	354	461	366	595	842	3
Aro	463	354	477	366	595	842	3
et	479	354	486	366	595	842	3
al.	488	354	497	366	595	842	3
2005;	499	354	521	366	595	842	3
Ward	523	354	544	366	595	842	3
et	546	354	553	366	595	842	3
al.	313	366	322	378	595	842	3
2006).	324	366	350	378	595	842	3
From	352	366	373	378	595	842	3
this	375	366	389	378	595	842	3
point	391	366	412	378	595	842	3
of	414	366	421	378	595	842	3
view,	423	366	443	378	595	842	3
higher	445	366	469	378	595	842	3
cellulase	471	366	503	378	595	842	3
and	505	366	519	378	595	842	3
xylanase	521	366	553	378	595	842	3
production	313	378	356	390	595	842	3
attained	359	378	390	390	595	842	3
by	392	378	402	390	595	842	3
A.	404	378	412	390	595	842	3
niger	415	378	433	390	595	842	3
biofilms	436	378	467	390	595	842	3
could	469	378	491	390	595	842	3
be	493	378	502	390	595	842	3
associated	504	378	543	390	595	842	3
to	545	378	553	390	595	842	3
differential	313	390	356	402	595	842	3
gene	360	390	377	402	595	842	3
expression	381	390	421	402	595	842	3
mechanisms.	425	390	475	402	595	842	3
As	479	390	489	402	595	842	3
was	493	390	507	402	595	842	3
mentioned	511	390	553	402	595	842	3
above,	313	402	338	414	595	842	3
RT-PCR	341	402	374	414	595	842	3
analysis	377	402	407	414	595	842	3
shows	409	402	432	414	595	842	3
different	435	402	468	414	595	842	3
moments	471	402	507	414	595	842	3
of	510	402	518	414	595	842	3
gene	521	402	538	414	595	842	3
ex-	541	402	553	414	595	842	3
pression	313	414	345	426	595	842	3
and,	347	414	364	426	595	842	3
in	367	414	375	426	595	842	3
general,	378	414	408	426	595	842	3
expression	410	414	450	426	595	842	3
levels	453	414	473	426	595	842	3
are	476	414	487	426	595	842	3
always	490	414	515	426	595	842	3
higher	518	414	542	426	595	842	3
in	545	414	553	426	595	842	3
biofilms.	313	426	347	438	595	842	3
Two	350	426	366	438	595	842	3
groups	369	426	395	438	595	842	3
of	398	426	406	438	595	842	3
genes	409	426	430	438	595	842	3
are	433	426	444	438	595	842	3
differentially	447	426	496	438	595	842	3
expressed:	499	426	538	438	595	842	3
the	541	426	553	438	595	842	3
first	313	438	328	450	595	842	3
is	330	438	336	450	595	842	3
comprised	338	438	378	450	595	842	3
by	381	438	390	450	595	842	3
eng1,	392	438	412	450	595	842	3
eglC	414	438	431	450	595	842	3
and	433	438	447	450	595	842	3
exo,	449	438	464	450	595	842	3
and	466	438	480	450	595	842	3
the	483	438	495	450	595	842	3
second	497	438	523	450	595	842	3
by	526	438	535	450	595	842	3
eglB	537	438	553	450	595	842	3
and	313	450	328	462	595	842	3
xynB.	330	450	351	462	595	842	3
The	354	450	368	462	595	842	3
former	371	450	397	462	595	842	3
is	400	450	405	462	595	842	3
principally	408	450	449	462	595	842	3
expressed	451	450	487	462	595	842	3
at	490	450	497	462	595	842	3
the	499	450	512	462	595	842	3
beginning	514	450	553	462	595	842	3
of	313	462	321	474	595	842	3
the	325	462	337	474	595	842	3
fermentation	341	462	391	474	595	842	3
period	395	462	420	474	595	842	3
and	423	462	438	474	595	842	3
the	442	462	454	474	595	842	3
latter	458	462	478	474	595	842	3
showed	481	462	510	474	595	842	3
more	514	462	534	474	595	842	3
that	538	462	553	474	595	842	3
one	313	474	327	486	595	842	3
band	330	474	349	486	595	842	3
in	352	474	360	486	595	842	3
the	363	474	375	486	595	842	3
gels	378	474	392	486	595	842	3
in	395	474	403	486	595	842	3
biofilm	405	474	433	486	595	842	3
samples.	436	474	468	486	595	842	3
Among	471	474	500	486	595	842	3
biofilm	503	474	531	486	595	842	3
over-	533	474	553	486	595	842	3
expressed	313	486	349	498	595	842	3
genes,	351	486	375	498	595	842	3
other	377	486	397	498	595	842	3
than	399	486	417	498	595	842	3
those	419	486	439	498	595	842	3
mentioned	441	486	483	498	595	842	3
above,	485	486	509	498	595	842	3
there	511	486	531	498	595	842	3
is	533	486	539	498	595	842	3
the	541	486	553	498	595	842	3
bgl2	313	498	329	510	595	842	3
gene	331	498	349	510	595	842	3
that	351	498	366	510	595	842	3
codes	368	498	389	510	595	842	3
for	391	498	402	510	595	842	3
a	404	498	408	510	595	842	3
β-glucosidase	410	497	461	509	595	842	3
with	463	498	481	510	595	842	3
exoglucohydrolase	482	498	553	510	595	842	3
activity	313	510	341	522	595	842	3
(Witte	344	510	369	522	595	842	3
&	372	510	380	522	595	842	3
Wartenberg	382	510	427	522	595	842	3
2004).	430	510	456	522	595	842	3
The	325	527	339	540	595	842	3
appearance	342	527	384	540	595	842	3
of	387	527	394	540	595	842	3
more	397	527	417	540	595	842	3
than	419	527	436	540	595	842	3
one	439	527	453	540	595	842	3
band	455	527	475	540	595	842	3
for	477	527	488	540	595	842	3
a	490	527	494	540	595	842	3
specific	497	527	525	540	595	842	3
gene	527	527	545	540	595	842	3
is	547	527	553	540	595	842	3
usual	313	539	333	552	595	842	3
in	335	539	343	552	595	842	3
transcriptional	345	539	402	552	595	842	3
studies	404	539	430	552	595	842	3
by	432	539	441	552	595	842	3
RT-PCR	444	539	477	552	595	842	3
(Donzelli	479	539	516	552	595	842	3
and	518	539	532	552	595	842	3
Har-	534	539	553	552	595	842	3
man	313	551	330	564	595	842	3
2001;	333	551	355	564	595	842	3
Dai	358	551	372	564	595	842	3
et	374	551	381	564	595	842	3
al.	384	551	393	564	595	842	3
2004;	395	551	417	564	595	842	3
Damveld	420	551	455	564	595	842	3
et	457	551	464	564	595	842	3
al.	467	551	476	564	595	842	3
2005)	478	551	501	564	595	842	3
and	504	551	518	564	595	842	3
it	520	551	526	564	595	842	3
can	528	551	542	564	595	842	3
be	544	551	553	564	595	842	3
explained	313	563	349	576	595	842	3
in	351	563	359	576	595	842	3
part	360	563	376	576	595	842	3
due	377	563	391	576	595	842	3
to	393	563	401	576	595	842	3
the	402	563	414	576	595	842	3
presence	416	563	448	576	595	842	3
of	450	563	457	576	595	842	3
similar	459	563	484	576	595	842	3
enzyme-encoding	486	563	553	576	595	842	3
Figure	57	766	81	777	595	842	3
2.	84	766	90	777	595	842	3
Analysis	93	766	123	777	595	842	3
of	125	766	132	777	595	842	3
expression	134	766	173	777	595	842	3
level	176	766	192	777	595	842	3
of	194	766	201	777	595	842	3
genes	204	766	225	777	595	842	3
coding	228	766	252	777	595	842	3
for	254	766	263	777	595	842	3
some	266	766	285	777	595	842	3
lignocellulolytic	288	766	341	777	595	842	3
enzymes	344	766	376	777	595	842	3
(see	378	766	394	777	595	842	3
table	396	766	414	777	595	842	3
1)	416	766	423	777	595	842	3
in	426	766	432	777	595	842	3
Aspergillus	435	766	474	777	595	842	3
niger	476	766	494	777	595	842	3
grown	497	766	518	777	595	842	3
in	521	766	527	777	595	842	3
biofilm	530	766	553	777	595	842	3
fermentation	57	776	101	787	595	842	3
(BF)	103	776	119	787	595	842	3
and	121	776	135	787	595	842	3
submerged	137	776	177	787	595	842	3
fermentation	179	776	223	787	595	842	3
(BF).	226	776	243	787	595	842	3
Rev.	57	798	70	810	595	842	3
peru.	73	798	90	810	595	842	3
biol.	92	798	107	810	595	842	3
15(2):	109	798	131	810	595	842	3
097-	133	798	149	810	595	842	3
102	151	798	165	810	595	842	3
(February	167	798	201	810	595	842	3
2009)	203	798	224	810	595	842	3
99	541	800	552	814	595	842	3
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	565	302	577	544	595	842	3
Results	71	287	107	301	595	842	3
and	110	287	128	301	595	842	3
discussions	130	287	188	301	595	842	3
A	68	303	74	316	595	842	3
transcriptomic	78	303	134	316	595	842	3
evaluation	137	303	177	316	595	842	3
of	180	303	188	316	595	842	3
A.	191	303	200	316	595	842	3
niger	203	303	221	316	595	842	3
under	225	303	247	316	595	842	3
biofilm	251	303	279	316	595	842	3
and	282	303	296	316	595	842	3
submerged	57	315	99	328	595	842	3
conditions	101	315	141	328	595	842	3
was	143	315	157	328	595	842	3
carried	159	315	185	328	595	842	3
out	187	315	200	328	595	842	3
by	202	315	211	328	595	842	3
using	213	315	234	328	595	842	3
RT-PCR	236	315	269	328	595	842	3
for	271	315	282	328	595	842	3
the	284	315	296	328	595	842	3
expression	57	327	96	340	595	842	3
of	99	327	107	340	595	842	3
some	109	327	129	340	595	842	3
lignocellulolytic	131	327	193	340	595	842	3
enzyme	195	327	225	340	595	842	3
genes.	227	327	250	340	595	842	3
Celobiohy-	253	327	296	340	595	842	3
drolase	57	339	84	352	595	842	3
A	87	339	93	352	595	842	3
(cbhA)	96	339	121	352	595	842	3
and	125	339	139	352	595	842	3
β-glucosidase	142	338	194	350	595	842	3
1	197	339	202	352	595	842	3
(bgl1)	205	339	227	352	595	842	3
genes	231	339	251	352	595	842	3
were	255	339	272	352	595	842	3
never	276	339	296	352	595	842	3
amplified	57	351	93	364	595	842	3
in	96	351	104	364	595	842	3
neither	108	351	135	364	595	842	3
fermentation	139	351	189	364	595	842	3
system	192	351	218	364	595	842	3
while	221	351	242	364	595	842	3
hydrophobin	246	351	296	364	595	842	3
gene	57	363	74	376	595	842	3
was	77	363	91	376	595	842	3
poorly	93	363	118	376	595	842	3
expressed	121	363	157	376	595	842	3
only	159	363	176	376	595	842	3
at	179	363	186	376	595	842	3
48	188	363	198	376	595	842	3
h	201	363	206	376	595	842	3
growth	208	363	236	376	595	842	3
in	238	363	246	376	595	842	3
BF.	249	363	261	376	595	842	3
Villena	42	31	71	42	595	842	4
et	74	31	82	42	595	842	4
al.	84	31	94	42	595	842	4
It	310	55	317	67	595	842	4
is	319	55	325	67	595	842	4
known	327	55	354	67	595	842	4
that	357	55	372	67	595	842	4
A.	374	55	383	67	595	842	4
niger	385	55	404	67	595	842	4
eglA,	406	55	425	67	595	842	4
eglB,	427	55	445	67	595	842	4
eglC,	448	55	466	67	595	842	4
cbhA,	469	55	490	67	595	842	4
cbhB,	493	55	514	67	595	842	4
xlnB,	519	55	539	67	595	842	4
xlnC	299	67	317	79	595	842	4
and	320	67	334	79	595	842	4
xlnD	336	67	356	79	595	842	4
genes	358	67	379	79	595	842	4
contain	381	67	410	79	595	842	4
binding	413	67	443	79	595	842	4
sequences	445	67	483	79	595	842	4
(GGCTAAA)	486	67	539	79	595	842	4
to	299	79	307	91	595	842	4
XlnR	309	79	330	91	595	842	4
protein	332	79	360	91	595	842	4
as	362	79	370	91	595	842	4
well	372	79	387	91	595	842	4
as	389	79	397	91	595	842	4
binding	399	79	429	91	595	842	4
sequences	431	79	469	91	595	842	4
to	471	79	479	91	595	842	4
CreA,	481	79	504	91	595	842	4
a	506	79	510	91	595	842	4
repres-	513	79	539	91	595	842	4
sor	299	91	310	103	595	842	4
protein	314	91	342	103	595	842	4
acting	345	91	369	103	595	842	4
in	372	91	380	103	595	842	4
the	384	91	396	103	595	842	4
presence	399	91	432	103	595	842	4
of	435	91	443	103	595	842	4
monomeric	446	91	491	103	595	842	4
sugars	494	91	518	103	595	842	4
(i.e.,	521	91	539	103	595	842	4
glucose)	299	103	330	115	595	842	4
as	333	103	341	115	595	842	4
a	343	103	347	115	595	842	4
self-regulating	350	103	405	115	595	842	4
mechanism	408	103	452	115	595	842	4
(Gielkens	455	103	491	115	595	842	4
et	494	103	501	115	595	842	4
al.	504	103	513	115	595	842	4
1999;	516	103	539	115	595	842	4
de	299	115	308	127	595	842	4
Vries	310	115	330	127	595	842	4
2001;	332	115	355	127	595	842	4
Hasper	357	115	385	127	595	842	4
et	387	115	394	127	595	842	4
al.	397	115	406	127	595	842	4
2002;	411	115	433	127	595	842	4
Aro	436	115	450	127	595	842	4
et	453	115	460	127	595	842	4
al.	462	115	471	127	595	842	4
2005).	474	115	499	127	595	842	4
However,	502	115	539	127	595	842	4
there	299	127	318	139	595	842	4
is	321	127	327	139	595	842	4
no	330	127	340	139	595	842	4
information	343	127	389	139	595	842	4
about	392	127	414	139	595	842	4
binding	417	127	447	139	595	842	4
sequences	450	127	487	139	595	842	4
to	490	127	498	139	595	842	4
XlnR	501	127	521	139	595	842	4
and	524	127	539	139	595	842	4
CreA	299	139	319	151	595	842	4
proteins	322	139	353	151	595	842	4
in	356	139	363	151	595	842	4
exo,	366	139	380	151	595	842	4
eng1	383	139	400	151	595	842	4
and	402	139	417	151	595	842	4
xynB	419	139	438	151	595	842	4
genes.	441	139	464	151	595	842	4
8	56	58	61	69	595	842	4
7	56	74	61	85	595	842	4
IU/mL	44	114	55	135	595	842	4
6	56	90	61	100	595	842	4
5	56	105	61	116	595	842	4
4	56	121	61	132	595	842	4
3	56	137	61	147	595	842	4
2	56	152	61	163	595	842	4
1	56	168	61	179	595	842	4
0	56	184	61	194	595	842	4
0	67	197	71	207	595	842	4
24	102	197	111	207	595	842	4
48	139	197	148	207	595	842	4
72	176	197	185	207	595	842	4
96	213	197	222	207	595	842	4
120	249	197	262	207	595	842	4
hours	152	208	173	219	595	842	4
BF	93	223	103	234	595	842	4
SF	110	223	120	234	595	842	4
BF	130	223	140	234	595	842	4
SF	147	223	157	234	595	842	4
BF	170	223	180	234	595	842	4
SF	187	223	197	234	595	842	4
BF	205	223	215	234	595	842	4
SF	222	223	232	234	595	842	4
BF	240	222	251	233	595	842	4
SF	257	222	268	233	595	842	4
xlnR	73	236	87	245	595	842	4
creA	73	247	88	257	595	842	4
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	19	299	30	541	595	842	4
EF	77	261	87	270	595	842	4
Figure	42	275	67	286	595	842	4
3.	69	275	76	286	595	842	4
Expression	78	275	117	285	595	842	4
of	119	275	126	285	595	842	4
cellulase	128	275	159	285	595	842	4
(FPA,	161	275	181	285	595	842	4
circles)	183	275	208	285	595	842	4
and	210	275	224	285	595	842	4
xylanase	226	275	257	285	595	842	4
(squa-	259	275	282	285	595	842	4
res)	42	284	56	295	595	842	4
regulatory	60	284	95	295	595	842	4
genes	99	284	120	295	595	842	4
as	124	284	132	295	595	842	4
related	136	284	160	295	595	842	4
to	163	284	170	295	595	842	4
enzyme	174	284	202	295	595	842	4
production	205	284	242	295	595	842	4
kinetics	246	284	272	295	595	842	4
in	276	284	282	295	595	842	4
Aspergillus	42	294	82	304	595	842	4
niger	84	294	102	304	595	842	4
grown	104	294	126	304	595	842	4
in	128	294	134	304	595	842	4
biofilm	136	294	159	304	595	842	4
fermentation	162	294	206	304	595	842	4
(BF,	208	294	222	304	595	842	4
closed	225	294	248	304	595	842	4
symbols)	250	294	282	304	595	842	4
and	42	303	56	314	595	842	4
submerged	58	303	98	314	595	842	4
fermentation	100	303	145	314	595	842	4
(SF,	147	303	161	314	595	842	4
open	163	303	181	314	595	842	4
symbols).	183	303	218	314	595	842	4
genes	42	329	63	341	595	842	4
with	66	329	83	341	595	842	4
a	85	329	90	341	595	842	4
high	92	329	109	341	595	842	4
degree	112	329	136	341	595	842	4
of	139	329	146	341	595	842	4
homology	149	329	188	341	595	842	4
(Kinoshita	190	329	231	341	595	842	4
et	233	329	240	341	595	842	4
al.,	242	329	254	341	595	842	4
1995),	256	329	282	341	595	842	4
gene	42	341	60	353	595	842	4
duplication	63	341	107	353	595	842	4
events	110	341	134	353	595	842	4
(Constanzo	137	341	181	353	595	842	4
et	184	341	191	353	595	842	4
al.	194	341	203	353	595	842	4
2006),	206	341	231	353	595	842	4
the	234	341	246	353	595	842	4
presence	249	341	282	353	595	842	4
of	42	353	50	365	595	842	4
genomic	52	353	85	365	595	842	4
DNA	88	353	109	365	595	842	4
in	112	353	119	365	595	842	4
the	122	353	134	365	595	842	4
reaction	136	353	167	365	595	842	4
sample	169	353	196	365	595	842	4
for	198	353	209	365	595	842	4
which	211	353	235	365	595	842	4
competitive	237	353	282	365	595	842	4
RT-PCR	42	365	76	377	595	842	4
is	80	365	85	377	595	842	4
recommended	89	365	144	377	595	842	4
(Damveld	148	365	186	377	595	842	4
et	190	365	197	377	595	842	4
al.	200	365	209	377	595	842	4
2005),	213	365	238	377	595	842	4
but	242	365	255	377	595	842	4
also	258	365	273	377	595	842	4
it	276	365	282	377	595	842	4
can	42	377	56	389	595	842	4
be	58	377	67	389	595	842	4
due	68	377	83	389	595	842	4
to	85	377	92	389	595	842	4
alternative	94	377	134	389	595	842	4
splicing	136	377	166	389	595	842	4
during	168	377	194	389	595	842	4
mRNA	195	377	224	389	595	842	4
processing	226	377	266	389	595	842	4
as	267	377	275	389	595	842	4
it	277	377	282	389	595	842	4
has	42	389	55	401	595	842	4
been	57	389	75	401	595	842	4
reported	77	389	110	401	595	842	4
for	112	389	123	401	595	842	4
several	125	389	150	401	595	842	4
genes	152	389	173	401	595	842	4
(Birch	175	389	199	401	595	842	4
et	201	389	208	401	595	842	4
al.,1995;	210	389	244	401	595	842	4
Lodato	246	389	273	401	595	842	4
et	275	389	282	401	595	842	4
al.,2003;	42	401	76	413	595	842	4
Yadav	78	401	100	413	595	842	4
et	102	401	109	413	595	842	4
al.	111	401	120	413	595	842	4
2003;	122	401	144	413	595	842	4
Baba	146	401	165	413	595	842	4
et	166	401	173	413	595	842	4
al.,	175	401	187	413	595	842	4
2005).	188	401	214	413	595	842	4
As	216	401	225	413	595	842	4
long	227	401	244	413	595	842	4
as	246	401	253	413	595	842	4
the	255	401	267	413	595	842	4
test	269	401	282	413	595	842	4
conditions	42	413	83	425	595	842	4
and	85	413	99	425	595	842	4
amplified	101	413	137	425	595	842	4
genes	139	413	160	425	595	842	4
were	162	413	179	425	595	842	4
equal	181	413	202	425	595	842	4
in	203	413	211	425	595	842	4
each	213	413	230	425	595	842	4
fermentation	232	413	282	425	595	842	4
system	42	425	68	437	595	842	4
as	71	425	78	437	595	842	4
well	81	425	97	437	595	842	4
as	100	425	107	437	595	842	4
the	110	425	122	437	595	842	4
same	125	425	144	437	595	842	4
strain	147	425	169	437	595	842	4
and	172	425	186	437	595	842	4
the	189	425	201	437	595	842	4
absence	204	425	234	437	595	842	4
of	236	425	244	437	595	842	4
contami-	247	425	282	437	595	842	4
nating	42	437	67	449	595	842	4
genomic	70	437	103	449	595	842	4
DNA,	107	437	131	449	595	842	4
the	134	437	147	449	595	842	4
appearance	150	437	193	449	595	842	4
of	196	437	204	449	595	842	4
other	207	437	227	449	595	842	4
bands	231	437	253	449	595	842	4
due	257	437	271	449	595	842	4
to	274	437	282	449	595	842	4
either	42	449	65	461	595	842	4
homology	68	449	107	461	595	842	4
or	110	449	118	461	595	842	4
gene	121	449	139	461	595	842	4
duplication	142	449	186	461	595	842	4
is	189	449	195	461	595	842	4
little	198	449	216	461	595	842	4
probable;	219	449	255	461	595	842	4
thus	258	449	275	461	595	842	4
a	278	449	282	461	595	842	4
possible	42	461	73	473	595	842	4
explanation	76	461	121	473	595	842	4
for	124	461	136	473	595	842	4
the	139	461	151	473	595	842	4
additional	154	461	194	473	595	842	4
bands	197	461	219	473	595	842	4
found	223	461	246	473	595	842	4
for	249	461	260	473	595	842	4
eglA,	264	461	282	473	595	842	4
eglB	42	473	58	485	595	842	4
and	61	473	76	485	595	842	4
xynB	79	473	98	485	595	842	4
genes	101	473	122	485	595	842	4
may	125	473	141	485	595	842	4
be	144	473	153	485	595	842	4
alternative	156	473	196	485	595	842	4
splicing.	200	473	232	485	595	842	4
This	235	473	251	485	595	842	4
process	254	473	282	485	595	842	4
can	42	485	56	497	595	842	4
regulate	59	485	89	497	595	842	4
the	93	485	105	497	595	842	4
expression	108	485	148	497	595	842	4
through	151	485	182	497	595	842	4
an	185	485	194	497	595	842	4
unusual	198	485	228	497	595	842	4
processing	231	485	271	497	595	842	4
of	274	485	282	497	595	842	4
the	42	497	55	509	595	842	4
same	57	497	76	509	595	842	4
gene	79	497	96	509	595	842	4
creating	99	497	129	509	595	842	4
different	132	497	165	509	595	842	4
reading	167	497	196	509	595	842	4
frames	198	497	224	509	595	842	4
(Galagan	226	497	261	509	595	842	4
et	264	497	271	509	595	842	4
al.	273	497	282	509	595	842	4
2005;	42	509	65	521	595	842	4
Stotz	68	509	87	521	595	842	4
et	90	509	97	521	595	842	4
al.	100	509	109	521	595	842	4
2006),	112	509	138	521	595	842	4
and	141	509	155	521	595	842	4
it	158	509	164	521	595	842	4
is	167	509	172	521	595	842	4
possible	175	509	206	521	595	842	4
that	209	509	224	521	595	842	4
the	227	509	239	521	595	842	4
alternative	242	509	282	521	595	842	4
splicing	42	521	72	533	595	842	4
may	74	521	91	533	595	842	4
be	93	521	102	533	595	842	4
responsible	104	521	147	533	595	842	4
for	149	521	160	533	595	842	4
cellulase	162	521	194	533	595	842	4
gene	196	521	214	533	595	842	4
diversity	216	521	248	533	595	842	4
(Baba	251	521	273	533	595	842	4
et	275	521	282	533	595	842	4
al.,	42	533	54	545	595	842	4
2005).	56	533	82	545	595	842	4
A	84	533	90	545	595	842	4
Northern	93	533	129	545	595	842	4
blot	131	533	147	545	595	842	4
analysis	149	533	178	545	595	842	4
together	180	533	212	545	595	842	4
with	214	533	232	545	595	842	4
the	234	533	246	545	595	842	4
sequenc-	248	533	282	545	595	842	4
ing	42	545	55	557	595	842	4
of	57	545	65	557	595	842	4
transcribed	67	545	110	557	595	842	4
bands	112	545	135	557	595	842	4
could	137	545	158	557	595	842	4
confirm	160	545	191	557	595	842	4
the	193	545	205	557	595	842	4
presence	208	545	240	557	595	842	4
of	242	545	250	557	595	842	4
variants	252	545	282	557	595	842	4
of	42	557	50	569	595	842	4
the	53	557	65	569	595	842	4
genes	67	557	88	569	595	842	4
studied	91	557	119	569	595	842	4
in	121	557	129	569	595	842	4
this	132	557	146	569	595	842	4
paper.	148	557	172	569	595	842	4
Aspergillus	54	574	93	587	595	842	4
niger	95	574	114	587	595	842	4
cellulase	116	574	148	587	595	842	4
and	150	574	164	587	595	842	4
xylanase	166	574	198	587	595	842	4
regulatory	200	574	239	587	595	842	4
genes	242	574	262	587	595	842	4
xlnR	265	574	282	587	595	842	4
and	42	586	57	599	595	842	4
creA	58	586	74	599	595	842	4
were	76	586	93	599	595	842	4
also	95	586	109	599	595	842	4
studied.	111	586	141	599	595	842	4
The	143	586	157	599	595	842	4
former	159	586	185	599	595	842	4
codes	186	586	207	599	595	842	4
for	209	586	220	599	595	842	4
a	221	586	225	599	595	842	4
transcriptional	227	586	282	599	595	842	4
activator	42	598	75	611	595	842	4
and	77	598	91	611	595	842	4
the	93	598	105	611	595	842	4
latter	107	598	126	611	595	842	4
codes	128	598	149	611	595	842	4
for	151	598	162	611	595	842	4
a	164	598	168	611	595	842	4
cellulase	169	598	201	611	595	842	4
repressor	202	598	236	611	595	842	4
protein	238	598	265	611	595	842	4
that	267	598	282	611	595	842	4
acts	42	610	57	623	595	842	4
principally	59	610	101	623	595	842	4
through	103	610	134	623	595	842	4
catabolite	137	610	174	623	595	842	4
repression.	177	610	218	623	595	842	4
Biofilm	220	610	249	623	595	842	4
cultures	252	610	282	623	595	842	4
expressed	42	622	79	635	595	842	4
xlnR	81	622	98	635	595	842	4
with	100	622	118	635	595	842	4
increasing	120	622	159	635	595	842	4
intensities	161	622	199	635	595	842	4
from	202	622	221	635	595	842	4
48	223	622	233	635	595	842	4
h	235	622	240	635	595	842	4
growth	242	622	270	635	595	842	4
up	272	622	282	635	595	842	4
to	42	634	50	647	595	842	4
the	54	634	66	647	595	842	4
end	69	634	83	647	595	842	4
of	86	634	94	647	595	842	4
the	97	634	109	647	595	842	4
fermentation	112	634	162	647	595	842	4
and	166	634	180	647	595	842	4
creA	183	634	199	647	595	842	4
from	202	634	221	647	595	842	4
72	224	634	234	647	595	842	4
h	237	634	242	647	595	842	4
up	246	634	256	647	595	842	4
to	259	634	267	647	595	842	4
the	270	634	282	647	595	842	4
end	42	646	57	659	595	842	4
of	59	646	67	659	595	842	4
the	70	646	82	659	595	842	4
fermentation.	85	646	137	659	595	842	4
On	140	646	153	659	595	842	4
the	156	646	168	659	595	842	4
contrary,	170	646	205	659	595	842	4
submerged	207	646	249	659	595	842	4
cultures	252	646	282	659	595	842	4
expressed	42	658	79	671	595	842	4
creA	81	658	97	671	595	842	4
at	100	658	107	671	595	842	4
24	110	658	120	671	595	842	4
h	122	658	127	671	595	842	4
growth	130	658	157	671	595	842	4
and	160	658	174	671	595	842	4
xlnR	177	658	194	671	595	842	4
at	197	658	204	671	595	842	4
48	207	658	217	671	595	842	4
h	219	658	225	671	595	842	4
and	227	658	242	671	595	842	4
96	244	658	254	671	595	842	4
h	257	658	262	671	595	842	4
with	265	658	282	671	595	842	4
very	42	670	58	683	595	842	4
little	60	670	77	683	595	842	4
intensity	79	670	112	683	595	842	4
(Fig.	114	670	131	683	595	842	4
3).	133	670	143	683	595	842	4
This	145	670	162	683	595	842	4
may	163	670	179	683	595	842	4
explain	181	670	208	683	595	842	4
that	210	670	225	683	595	842	4
higher	227	670	251	683	595	842	4
enzyme	253	670	282	683	595	842	4
activities	42	682	76	695	595	842	4
found	78	682	101	695	595	842	4
in	103	682	111	695	595	842	4
BF	113	682	124	695	595	842	4
could	126	682	148	695	595	842	4
be	150	682	159	695	595	842	4
related	161	682	187	695	595	842	4
to	189	682	197	695	595	842	4
transcriptional	199	682	255	695	595	842	4
activa-	257	682	282	695	595	842	4
tion	42	694	58	707	595	842	4
by	60	694	69	707	595	842	4
XlnR	71	694	91	707	595	842	4
protein;	93	694	123	707	595	842	4
however,	125	694	159	707	595	842	4
the	160	694	173	707	595	842	4
lack	174	694	189	707	595	842	4
of	191	694	199	707	595	842	4
XlnR	201	694	221	707	595	842	4
activation	223	694	260	707	595	842	4
in	262	694	270	707	595	842	4
SF	272	694	282	707	595	842	4
is	42	706	48	719	595	842	4
not	51	706	64	719	595	842	4
clear	67	706	85	719	595	842	4
but	87	706	101	719	595	842	4
it	103	706	109	719	595	842	4
may	112	706	128	719	595	842	4
suggest	131	706	158	719	595	842	4
different	161	706	194	719	595	842	4
regulatory	196	706	235	719	595	842	4
mechanism	238	706	282	719	595	842	4
and	42	718	57	731	595	842	4
probably	60	718	94	731	595	842	4
synergistic	97	718	137	731	595	842	4
with	140	718	157	731	595	842	4
XlnR	160	718	181	731	595	842	4
in	184	718	192	731	595	842	4
biofilms.	194	718	228	731	595	842	4
A	231	718	237	731	595	842	4
differential	240	718	282	731	595	842	4
transcription	42	730	92	743	595	842	4
analysis	95	730	124	743	595	842	4
using	128	730	148	743	595	842	4
xlnR	151	730	169	743	595	842	4
and	172	730	186	743	595	842	4
creA	189	730	205	743	595	842	4
mutants	209	730	240	743	595	842	4
in	243	730	251	743	595	842	4
SF	254	730	265	743	595	842	4
and	268	730	282	743	595	842	4
BF	42	742	54	755	595	842	4
could	56	742	78	755	595	842	4
clarify	80	742	104	755	595	842	4
such	107	742	124	755	595	842	4
regulatory	127	742	166	755	595	842	4
mechanisms	168	742	215	755	595	842	4
(Mogensen	218	742	261	755	595	842	4
et	263	742	271	755	595	842	4
al.	273	742	282	755	595	842	4
2006).	42	754	68	767	595	842	4
100	42	800	59	814	595	842	4
Iwashita	310	156	342	169	595	842	4
(2002)	345	156	371	169	595	842	4
has	373	156	386	169	595	842	4
suggested	388	156	424	169	595	842	4
that	427	156	442	169	595	842	4
high	444	156	462	169	595	842	4
enzyme	464	156	493	169	595	842	4
production	495	156	539	169	595	842	4
in	299	168	307	181	595	842	4
SSF	309	168	325	181	595	842	4
may	327	168	344	181	595	842	4
be	346	168	355	181	595	842	4
due	358	168	372	181	595	842	4
to	374	168	382	181	595	842	4
a	385	168	389	181	595	842	4
specific	392	168	420	181	595	842	4
solid-state	422	168	461	181	595	842	4
signal	464	168	486	181	595	842	4
responsive	488	168	528	181	595	842	4
to	531	168	539	181	595	842	4
a	299	180	303	193	595	842	4
w	303	188	307	195	595	842	4
and	309	180	324	193	595	842	4
to	326	180	334	193	595	842	4
an	336	180	346	193	595	842	4
unidentified	348	180	395	193	595	842	4
trans	398	180	416	193	595	842	4
activator	418	180	451	193	595	842	4
that	454	180	469	193	595	842	4
would	471	180	495	193	595	842	4
cause	498	180	518	193	595	842	4
both	520	180	539	193	595	842	4
morphological	299	192	356	205	595	842	4
and	360	192	375	205	595	842	4
physiological	379	192	430	205	595	842	4
changes	434	192	464	205	595	842	4
and	468	192	483	205	595	842	4
trigger	487	192	512	205	595	842	4
a	516	192	520	205	595	842	4
dif-	524	192	538	205	595	842	4
ferential	299	204	330	217	595	842	4
gene	333	204	351	217	595	842	4
expression.	354	204	396	217	595	842	4
According	399	204	439	217	595	842	4
to	442	204	450	217	595	842	4
our	452	204	466	217	595	842	4
former	469	204	495	217	595	842	4
hypothesis	498	204	539	217	595	842	4
(Gutiérrez-Correa	299	216	368	229	595	842	4
&	371	216	379	229	595	842	4
Villena,	382	216	412	229	595	842	4
2003)	415	216	438	229	595	842	4
this	441	216	455	229	595	842	4
specific	457	216	486	229	595	842	4
signal	488	216	510	229	595	842	4
for	513	216	524	229	595	842	4
BF	527	216	539	229	595	842	4
could	299	228	321	241	595	842	4
be	323	228	332	241	595	842	4
stimulated	335	228	375	241	595	842	4
by	378	228	387	241	595	842	4
cell	390	228	403	241	595	842	4
adhesion	406	228	440	241	595	842	4
since	443	228	462	241	595	842	4
temperature	464	228	511	241	595	842	4
and	514	228	528	241	595	842	4
a	531	228	535	241	595	842	4
w	535	236	539	243	595	842	4
are	299	240	310	253	595	842	4
similar	313	240	339	253	595	842	4
in	343	240	350	253	595	842	4
SF	354	240	364	253	595	842	4
and	367	240	381	253	595	842	4
BF,	384	240	397	253	595	842	4
and	400	240	414	253	595	842	4
a	418	240	422	253	595	842	4
w	422	248	425	255	595	842	4
has	429	240	441	253	595	842	4
not	444	240	457	253	595	842	4
showed	460	240	489	253	595	842	4
any	492	240	506	253	595	842	4
positive	509	240	539	253	595	842	4
influence	299	252	334	265	595	842	4
in	337	252	345	265	595	842	4
BF	347	252	359	265	595	842	4
(Villena	361	252	392	265	595	842	4
&	394	252	403	265	595	842	4
Gutiérrez-Correa,	405	252	473	265	595	842	4
2007b).	476	252	507	265	595	842	4
Other	310	270	334	283	595	842	4
important	338	270	377	283	595	842	4
factor	381	270	404	283	595	842	4
in	407	270	415	283	595	842	4
the	419	270	431	283	595	842	4
regulation	435	270	474	283	595	842	4
of	478	270	486	283	595	842	4
gene	490	270	508	283	595	842	4
expres-	512	270	539	283	595	842	4
sion	299	282	315	295	595	842	4
is	319	282	325	295	595	842	4
related	329	282	355	295	595	842	4
to	359	282	367	295	595	842	4
mRNA	370	282	399	295	595	842	4
stability.	403	282	435	295	595	842	4
The	439	282	454	295	595	842	4
expression	458	282	498	295	595	842	4
level	502	282	519	295	595	842	4
of	523	282	531	295	595	842	4
a	534	282	539	295	595	842	4
gene	299	294	317	307	595	842	4
transcript	320	294	357	307	595	842	4
is	360	294	366	307	595	842	4
a	369	294	373	307	595	842	4
function	376	294	409	307	595	842	4
of	413	294	420	307	595	842	4
both	424	294	442	307	595	842	4
its	445	294	454	307	595	842	4
synthesis	457	294	491	307	595	842	4
rate	494	294	509	307	595	842	4
and	512	294	526	307	595	842	4
its	530	294	539	307	595	842	4
degradation	299	306	345	319	595	842	4
rate,	348	306	364	319	595	842	4
the	367	306	379	319	595	842	4
latter	382	306	402	319	595	842	4
being	405	306	426	319	595	842	4
important	429	306	468	319	595	842	4
in	471	306	478	319	595	842	4
controlling	481	306	524	319	595	842	4
the	526	306	539	319	595	842	4
cell	299	318	312	331	595	842	4
adaptative	316	318	356	331	595	842	4
capability.	360	318	399	331	595	842	4
Thus,	403	318	425	331	595	842	4
mRNA	428	318	457	331	595	842	4
recycling	461	318	496	331	595	842	4
gives	499	318	518	331	595	842	4
cells	522	318	538	331	595	842	4
flexibility	299	330	335	343	595	842	4
to	338	330	346	343	595	842	4
perform	350	330	381	343	595	842	4
rapid	384	330	404	343	595	842	4
changes	408	330	438	343	595	842	4
in	441	330	449	343	595	842	4
response	452	330	485	343	595	842	4
to	488	330	496	343	595	842	4
regulatory	500	330	539	343	595	842	4
signals	299	342	324	355	595	842	4
(Caddick	328	342	364	355	595	842	4
et	367	342	374	355	595	842	4
al.,	378	342	390	355	595	842	4
2006).	393	342	419	355	595	842	4
This	423	342	439	355	595	842	4
mechanism	443	342	487	355	595	842	4
could	491	342	512	355	595	842	4
be	516	342	525	355	595	842	4
ef-	528	342	539	355	595	842	4
ficiently	299	354	330	367	595	842	4
coordinated	333	354	379	367	595	842	4
in	382	354	390	367	595	842	4
biofilms	393	354	424	367	595	842	4
and	428	354	442	367	595	842	4
it	445	354	451	367	595	842	4
would	454	354	478	367	595	842	4
explain	481	354	509	367	595	842	4
in	512	354	520	367	595	842	4
part	523	354	539	367	595	842	4
their	299	366	317	379	595	842	4
higher	319	366	343	379	595	842	4
transcriptional	345	366	401	379	595	842	4
levels	403	366	423	379	595	842	4
of	425	366	433	379	595	842	4
cellulase	435	366	466	379	595	842	4
and	468	366	482	379	595	842	4
xylanase	484	366	516	379	595	842	4
genes	518	366	538	379	595	842	4
as	299	378	306	391	595	842	4
it	309	378	314	391	595	842	4
is	317	378	323	391	595	842	4
showed	325	378	354	391	595	842	4
in	356	378	364	391	595	842	4
Figure	367	378	391	391	595	842	4
2.	394	378	401	391	595	842	4
Conclusions	313	395	373	409	595	842	4
It	310	411	317	423	595	842	4
seems	320	411	342	423	595	842	4
that	345	411	360	423	595	842	4
cell	364	411	377	423	595	842	4
adhesion	380	411	414	423	595	842	4
is	417	411	423	423	595	842	4
the	426	411	438	423	595	842	4
most	441	411	460	423	595	842	4
important	464	411	503	423	595	842	4
stimulus	506	411	539	423	595	842	4
responsible	299	423	342	435	595	842	4
for	344	423	355	435	595	842	4
biofilm	357	423	385	435	595	842	4
development	387	423	436	435	595	842	4
and	438	423	453	435	595	842	4
its	455	423	463	435	595	842	4
particular	465	423	502	435	595	842	4
morpho-	504	423	539	435	595	842	4
genetic	299	435	326	447	595	842	4
and	328	435	343	447	595	842	4
physiological	344	435	395	447	595	842	4
responses	397	435	433	447	595	842	4
derived	434	435	463	447	595	842	4
from	465	435	483	447	595	842	4
this	485	435	499	447	595	842	4
biological	501	435	539	447	595	842	4
process	299	447	327	459	595	842	4
in	330	447	338	459	595	842	4
accordance	341	447	383	459	595	842	4
to	387	447	395	459	595	842	4
our	398	447	411	459	595	842	4
former	415	447	441	459	595	842	4
hypothesis,	444	447	487	459	595	842	4
which	491	447	514	459	595	842	4
is	517	447	523	459	595	842	4
the	526	447	539	459	595	842	4
basis	299	459	317	471	595	842	4
of	319	459	327	471	595	842	4
Surface	329	459	357	471	595	842	4
Adhesion	359	459	395	471	595	842	4
Fermentation.	397	459	452	471	595	842	4
Although	454	459	490	471	595	842	4
preliminary,	492	459	539	471	595	842	4
results	299	471	323	483	595	842	4
presented	327	471	364	483	595	842	4
in	368	471	375	483	595	842	4
this	379	471	393	483	595	842	4
paper	397	471	418	483	595	842	4
show	422	471	442	483	595	842	4
that,	446	471	463	483	595	842	4
at	467	471	474	483	595	842	4
least	478	471	495	483	595	842	4
for	499	471	510	483	595	842	4
several	513	471	539	483	595	842	4
enzyme-encoding	299	483	366	495	595	842	4
genes,	368	483	391	495	595	842	4
a	393	483	397	495	595	842	4
differential	399	483	440	495	595	842	4
gene	442	483	459	495	595	842	4
expression	461	483	500	495	595	842	4
is	502	483	508	495	595	842	4
actually	509	483	539	495	595	842	4
active	299	495	321	507	595	842	4
when	324	495	344	507	595	842	4
A.	347	495	356	507	595	842	4
niger	358	495	377	507	595	842	4
grows	379	495	401	507	595	842	4
as	404	495	411	507	595	842	4
a	414	495	418	507	595	842	4
biofilm.	420	495	451	507	595	842	4
Also,	454	495	473	507	595	842	4
it	475	495	481	507	595	842	4
seems	484	495	506	507	595	842	4
that	508	495	524	507	595	842	4
the	526	495	539	507	595	842	4
regulatory	299	507	338	519	595	842	4
mechanism	340	507	384	519	595	842	4
for	386	507	397	519	595	842	4
cellulase	400	507	431	519	595	842	4
and	433	507	448	519	595	842	4
xylanase	450	507	482	519	595	842	4
synthesis	484	507	518	519	595	842	4
in	520	507	528	519	595	842	4
A.	530	507	539	519	595	842	4
niger	299	519	318	531	595	842	4
biofilms	320	519	351	531	595	842	4
is	354	519	359	531	595	842	4
quite	362	519	382	531	595	842	4
different	384	519	417	531	595	842	4
from	419	519	438	531	595	842	4
that	441	519	456	531	595	842	4
prevailing	459	519	496	531	595	842	4
in	499	519	507	531	595	842	4
A.	509	519	518	531	595	842	4
niger	520	519	539	531	595	842	4
when	299	531	320	543	595	842	4
growing	322	531	354	543	595	842	4
in	356	531	364	543	595	842	4
submerged	366	531	408	543	595	842	4
fermentation.	410	531	463	543	595	842	4
Most	465	531	485	543	595	842	4
of	488	531	496	543	595	842	4
the	498	531	510	543	595	842	4
studies	512	531	539	543	595	842	4
done	299	543	318	555	595	842	4
on	320	543	330	555	595	842	4
enzyme	331	543	360	555	595	842	4
synthesis	362	543	395	555	595	842	4
and	397	543	411	555	595	842	4
regulation	412	543	451	555	595	842	4
in	452	543	460	555	595	842	4
fungi	462	543	482	555	595	842	4
have	483	543	500	555	595	842	4
been	502	543	520	555	595	842	4
con-	522	543	539	555	595	842	4
ducted	299	555	325	567	595	842	4
in	327	555	334	567	595	842	4
submerged	336	555	377	567	595	842	4
cultivation	379	555	419	567	595	842	4
without	421	555	451	567	595	842	4
considering	453	555	496	567	595	842	4
the	498	555	510	567	595	842	4
natural	512	555	539	567	595	842	4
tendency	299	567	334	579	595	842	4
of	336	567	344	579	595	842	4
filamentous	346	567	391	579	595	842	4
fungi	394	567	414	579	595	842	4
to	416	567	424	579	595	842	4
grow	427	567	446	579	595	842	4
adhered	448	567	479	579	595	842	4
to	481	567	489	579	595	842	4
surfaces	491	567	521	579	595	842	4
as	523	567	531	579	595	842	4
it	533	567	539	579	595	842	4
occurs	299	579	323	591	595	842	4
in	325	579	333	591	595	842	4
nature.	335	579	362	591	595	842	4
We	363	579	376	591	595	842	4
are	378	579	389	591	595	842	4
conducting	391	579	434	591	595	842	4
a	436	579	440	591	595	842	4
global	442	579	465	591	595	842	4
transcriptomic	467	579	522	591	595	842	4
and	524	579	538	591	595	842	4
proteomic	299	591	339	603	595	842	4
analysis	341	591	370	603	595	842	4
of	373	591	381	603	595	842	4
A.	383	591	392	603	595	842	4
niger	394	591	413	603	595	842	4
biofilms	415	591	447	603	595	842	4
to	449	591	457	603	595	842	4
clarify	460	591	483	603	595	842	4
the	486	591	498	603	595	842	4
process	501	591	528	603	595	842	4
of	531	591	539	603	595	842	4
cell	299	603	312	615	595	842	4
adhesion	314	603	349	615	595	842	4
as	351	603	358	615	595	842	4
related	361	603	387	615	595	842	4
to	389	603	397	615	595	842	4
biofilm	400	603	428	615	595	842	4
fermentation.	430	603	483	615	595	842	4
Acknowledgments	313	619	402	633	595	842	4
This	310	635	327	648	595	842	4
work	329	635	349	648	595	842	4
was	351	635	365	648	595	842	4
supported	368	635	407	648	595	842	4
by	409	635	418	648	595	842	4
INCAGRO	421	635	467	648	595	842	4
(Ministry	469	635	506	648	595	842	4
of	508	635	516	648	595	842	4
Agri-	519	635	539	648	595	842	4
culture,	299	647	328	660	595	842	4
Peru),	330	647	352	660	595	842	4
CONCYTEC	354	647	408	660	595	842	4
(Ministry	410	647	446	660	595	842	4
of	448	647	455	660	595	842	4
Education,	457	647	498	660	595	842	4
Peru),	500	647	523	660	595	842	4
and	524	647	539	660	595	842	4
the	299	659	311	672	595	842	4
Institute	313	659	345	672	595	842	4
of	347	659	355	672	595	842	4
Molecular	356	659	395	672	595	842	4
Biology	397	659	426	672	595	842	4
and	428	659	442	672	595	842	4
Biotechnology	444	659	499	672	595	842	4
(Shizuoka	501	659	539	672	595	842	4
University,	299	671	340	684	595	842	4
Japan).	343	671	370	684	595	842	4
Literature	313	688	359	702	595	842	4
cited	362	688	385	702	595	842	4
Aro	299	702	313	714	595	842	4
N.,	318	702	329	714	595	842	4
T.	331	702	338	714	595	842	4
Pakula	341	702	365	714	595	842	4
&	368	702	375	714	595	842	4
M.	377	702	388	714	595	842	4
Penttilä.	390	702	420	714	595	842	4
2005.	422	702	443	714	595	842	4
Transcriptional	445	702	500	714	595	842	4
regulation	502	702	539	714	595	842	4
of	334	713	342	725	595	842	4
plant	343	713	361	725	595	842	4
cell	363	713	376	725	595	842	4
wall	377	713	393	725	595	842	4
degradation	394	713	437	725	595	842	4
by	438	713	447	725	595	842	4
filamentous	449	713	491	725	595	842	4
fungi.	492	713	513	725	595	842	4
FEMS	515	713	539	725	595	842	4
Microbiol.	334	724	372	736	595	842	4
Rev.	375	724	391	736	595	842	4
29:	393	724	404	736	595	842	4
719–739.	407	724	440	736	595	842	4
BabaY.,	299	735	328	747	595	842	4
A.	331	735	340	747	595	842	4
Shimonaka,	344	735	388	747	595	842	4
J.	391	735	397	747	595	842	4
Koga,	401	735	423	747	595	842	4
H.	427	735	436	747	595	842	4
Kubota	439	735	466	747	595	842	4
&	470	735	477	747	595	842	4
T.	480	735	488	747	595	842	4
Kono.	491	735	514	747	595	842	4
2005.	518	735	538	747	595	842	4
Alternative	334	746	375	758	595	842	4
Splicing	377	746	407	758	595	842	4
Produces	409	746	442	758	595	842	4
Two	444	746	460	758	595	842	4
Endoglucanases	462	746	520	758	595	842	4
with	523	746	539	758	595	842	4
One	334	756	349	768	595	842	4
or	353	756	360	768	595	842	4
Two	363	756	379	768	595	842	4
Carbohydrate-Binding	383	756	465	768	595	842	4
Modules	468	756	500	768	595	842	4
in	504	756	511	768	595	842	4
Mucor	514	756	539	768	595	842	4
circinelloides.	334	767	385	779	595	842	4
J.	387	767	393	779	595	842	4
Bacteriol.	395	767	430	779	595	842	4
187:	433	767	449	779	595	842	4
3045–3051.	451	767	494	779	595	842	4
Rev.	376	798	390	810	595	842	4
peru.	392	798	409	810	595	842	4
biol.	411	798	426	810	595	842	4
15(2):	428	798	450	810	595	842	4
097-	452	798	468	810	595	842	4
102	470	798	484	810	595	842	4
(Febrero	486	798	515	810	595	842	4
2009)	518	798	539	810	595	842	4
Gene	246	30	266	42	595	842	5
expression	269	30	309	42	595	842	5
of	311	30	320	42	595	842	5
some	322	30	341	42	595	842	5
lignocellulolytic	343	30	413	42	595	842	5
enzymes	415	30	446	42	595	842	5
in	448	30	456	42	595	842	5
A	458	30	464	42	595	842	5
spergillus	464	33	498	41	595	842	5
niger	501	33	519	41	595	842	5
biofilms	521	30	553	42	595	842	5
Rev.	57	798	70	810	595	842	5
peru.	73	798	90	810	595	842	5
biol.	92	798	107	810	595	842	5
15(2):	109	798	131	810	595	842	5
097-	133	798	149	810	595	842	5
102	151	798	165	810	595	842	5
(February	167	798	201	810	595	842	5
2009)	203	798	224	810	595	842	5
Hölker	313	54	338	66	595	842	5
U.,	340	54	351	66	595	842	5
M.	353	54	363	66	595	842	5
Höfer,	365	54	388	66	595	842	5
&	389	54	396	66	595	842	5
J.	398	54	404	66	595	842	5
Lenz.	406	54	426	66	595	842	5
2004.	428	54	448	66	595	842	5
Biotechnological	450	54	511	66	595	842	5
advantages	513	54	553	66	595	842	5
of	348	65	356	77	595	842	5
laboratory-scale	359	65	418	77	595	842	5
solid-state	421	65	459	77	595	842	5
fermentation	462	65	508	77	595	842	5
with	512	65	528	77	595	842	5
fungi.	531	65	553	77	595	842	5
Appl.	348	75	368	87	595	842	5
Microbiol.	371	75	409	87	595	842	5
Biotechnol.	411	75	453	87	595	842	5
64:	455	75	467	87	595	842	5
175-186.	469	75	501	87	595	842	5
Iqbal	313	86	332	98	595	842	5
M.	334	86	344	98	595	842	5
&	347	86	354	98	595	842	5
A.	356	86	364	98	595	842	5
Saeed.	367	86	391	98	595	842	5
2005.	393	86	413	98	595	842	5
Novel	416	86	438	98	595	842	5
method	440	86	467	98	595	842	5
for	469	86	480	98	595	842	5
cell	482	86	495	98	595	842	5
immobilization	498	86	553	98	595	842	5
and	348	97	361	109	595	842	5
its	364	97	373	109	595	842	5
application	376	97	416	109	595	842	5
for	419	97	430	109	595	842	5
production	433	97	472	109	595	842	5
of	475	97	483	109	595	842	5
organic	486	97	512	109	595	842	5
acid.	516	97	533	109	595	842	5
Lett.	536	97	553	109	595	842	5
Appl.	348	108	368	120	595	842	5
Microbiol.	371	108	409	120	595	842	5
40:	411	108	423	120	595	842	5
178-182.	425	108	457	120	595	842	5
Iwashita,	313	119	346	131	595	842	5
K.	348	119	357	131	595	842	5
2002.	359	119	379	131	595	842	5
Recent	381	119	406	131	595	842	5
Studies	408	119	434	131	595	842	5
of	436	119	444	131	595	842	5
Protein	446	119	472	131	595	842	5
Secretion	473	119	507	131	595	842	5
by	509	119	518	131	595	842	5
Filamen-	520	119	553	131	595	842	5
tous	348	129	363	141	595	842	5
Fungi.	365	129	389	141	595	842	5
J.	391	129	397	141	595	842	5
Biosc.	399	129	422	141	595	842	5
Bioeng.	426	129	455	141	595	842	5
94:	457	129	468	141	595	842	5
530-535.	471	129	503	141	595	842	5
Kim	313	140	329	152	595	842	5
S.	331	140	339	152	595	842	5
&	341	140	348	152	595	842	5
B.E.	352	140	368	152	595	842	5
Dale.	370	140	389	152	595	842	5
2004.	391	140	411	152	595	842	5
Global	414	140	438	152	595	842	5
potential	440	140	472	152	595	842	5
bioethanol	474	140	512	152	595	842	5
production	514	140	553	152	595	842	5
from	348	151	366	163	595	842	5
wasted	368	151	393	163	595	842	5
crops	395	151	414	163	595	842	5
and	416	151	429	163	595	842	5
crop	431	151	447	163	595	842	5
residues.	449	151	481	163	595	842	5
Biomass	483	151	514	163	595	842	5
Bioenergy	515	151	553	163	595	842	5
26:	348	162	360	174	595	842	5
361-375.	362	162	394	174	595	842	5
Kinoshita	313	173	348	185	595	842	5
K.,	351	173	362	185	595	842	5
M.	365	173	376	185	595	842	5
Takano,	379	173	407	185	595	842	5
T.	410	173	417	185	595	842	5
Koseki,	421	173	448	185	595	842	5
K.	455	173	463	185	595	842	5
Ito	466	173	476	185	595	842	5
&	480	173	487	185	595	842	5
K.	493	173	502	185	595	842	5
Iwano.	505	173	529	185	595	842	5
1995.	533	173	553	185	595	842	5
Cloning	348	183	377	195	595	842	5
of	379	183	387	195	595	842	5
the	389	183	400	195	595	842	5
xynB	402	183	422	195	595	842	5
gene	424	183	441	195	595	842	5
encoding	443	183	476	195	595	842	5
xylanase	479	183	510	195	595	842	5
B	512	183	518	195	595	842	5
from	521	183	538	195	595	842	5
As-	540	183	553	195	595	842	5
pergillus	348	194	379	206	595	842	5
niger	381	194	399	206	595	842	5
and	401	194	414	206	595	842	5
Its	416	194	425	206	595	842	5
Expression	426	194	466	206	595	842	5
in	468	194	475	206	595	842	5
Aspergillus	476	194	517	206	595	842	5
kawachii.	518	194	553	206	595	842	5
J.	348	205	354	217	595	842	5
Ferment.	356	205	388	217	595	842	5
Bioeng.	391	205	419	217	595	842	5
79:	421	205	433	217	595	842	5
422-428.	435	205	467	217	595	842	5
Lodato	313	216	339	228	595	842	5
P.,	342	216	350	228	595	842	5
J.	353	216	359	228	595	842	5
Alcaino,	362	216	392	228	595	842	5
S.	395	216	403	228	595	842	5
Barahona,	406	216	443	228	595	842	5
P.	446	216	452	228	595	842	5
Retamales	455	216	492	228	595	842	5
&	495	216	502	228	595	842	5
V.	505	216	513	228	595	842	5
Cifuentes.	516	216	553	228	595	842	5
2003.	348	227	368	239	595	842	5
Alternative	374	227	414	239	595	842	5
Splicing	417	227	447	239	595	842	5
of	450	227	458	239	595	842	5
Transcripts	461	227	501	239	595	842	5
from	504	227	521	239	595	842	5
crtI	524	227	537	239	595	842	5
and	540	227	553	239	595	842	5
crtYB	348	237	370	249	595	842	5
Genes	373	237	396	249	595	842	5
of	399	237	406	249	595	842	5
Xanthophyllomyces	409	237	482	249	595	842	5
dendrorhous	485	237	530	249	595	842	5
Appl.	533	237	553	249	595	842	5
Environ.	348	248	379	260	595	842	5
Microbiol.	382	248	420	260	595	842	5
69:	422	248	434	260	595	842	5
4676–4682.	436	248	479	260	595	842	5
Mogensen	313	259	351	271	595	842	5
J.,	353	259	361	271	595	842	5
H.B.	363	259	380	271	595	842	5
Nielsen,	381	259	411	271	595	842	5
G.	413	259	422	271	595	842	5
Hofmann	424	259	458	271	595	842	5
&	460	259	467	271	595	842	5
J.	468	259	474	271	595	842	5
Nielsen.	476	259	506	271	595	842	5
2006.	508	259	528	271	595	842	5
Trans-	530	259	553	271	595	842	5
cription	348	270	376	282	595	842	5
analysis	377	270	406	282	595	842	5
using	407	270	426	282	595	842	5
high-density	428	270	472	282	595	842	5
micro-arrays	474	270	519	282	595	842	5
of	520	270	528	282	595	842	5
Asper-	529	270	553	282	595	842	5
gillus	348	281	368	293	595	842	5
nidulans	370	281	401	293	595	842	5
wild-type	403	281	438	293	595	842	5
and	440	281	453	293	595	842	5
creA	455	281	473	293	595	842	5
mutant	474	281	499	293	595	842	5
during	502	281	525	293	595	842	5
growth	527	281	553	293	595	842	5
on	348	291	357	303	595	842	5
glucose	359	291	387	303	595	842	5
or	389	291	397	303	595	842	5
ethanol.	399	291	428	303	595	842	5
Fungal	430	291	455	303	595	842	5
Genet.	457	291	481	303	595	842	5
Biol.	483	291	501	303	595	842	5
43:	503	291	515	303	595	842	5
593–603.	517	291	551	303	595	842	5
Mowat	313	302	339	314	595	842	5
E.,	342	302	352	314	595	842	5
J.	354	302	360	314	595	842	5
Butcher,	363	302	393	314	595	842	5
S.	396	302	404	314	595	842	5
Lang,	406	302	427	314	595	842	5
C.	430	302	438	314	595	842	5
Williams	441	302	474	314	595	842	5
&	476	302	483	314	595	842	5
G.	486	302	495	314	595	842	5
Ramage.	498	302	530	314	595	842	5
2007.	533	302	553	314	595	842	5
Development	348	313	397	325	595	842	5
of	398	313	406	325	595	842	5
a	407	313	411	325	595	842	5
simple	413	313	437	325	595	842	5
model	439	313	461	325	595	842	5
for	463	313	473	325	595	842	5
studying	475	313	506	325	595	842	5
the	507	313	518	325	595	842	5
effects	520	313	544	325	595	842	5
of	545	313	553	325	595	842	5
antifungal	348	324	384	336	595	842	5
agents	385	324	408	336	595	842	5
on	410	324	418	336	595	842	5
multicellular	420	324	465	336	595	842	5
communities	466	324	512	336	595	842	5
of	513	324	521	336	595	842	5
Aspergi-	522	324	553	336	595	842	5
llus	348	335	361	347	595	842	5
fumigatus.	364	335	402	347	595	842	5
J.	404	335	410	347	595	842	5
Med.	412	335	431	347	595	842	5
Microbiol.	433	335	471	347	595	842	5
56:	473	335	485	347	595	842	5
1205–1212.	487	335	530	347	595	842	5
Mowat	313	345	339	357	595	842	5
E.,	341	345	351	357	595	842	5
S.	353	345	360	357	595	842	5
Lang,	362	345	383	357	595	842	5
C.	385	345	394	357	595	842	5
Williams,	395	345	430	357	595	842	5
E.	433	345	440	357	595	842	5
McCulloch,	442	345	485	357	595	842	5
B.	487	345	496	357	595	842	5
Jones	498	345	518	357	595	842	5
&	520	345	527	357	595	842	5
G.	529	345	538	357	595	842	5
Ra-	540	345	553	357	595	842	5
mage.	348	356	370	368	595	842	5
2008a.	372	356	396	368	595	842	5
Phase-dependent	398	356	459	368	595	842	5
antifungal	460	356	497	368	595	842	5
activity	499	356	526	368	595	842	5
against	527	356	553	368	595	842	5
Aspergillus	348	367	390	379	595	842	5
fumigatus	392	367	428	379	595	842	5
developing	431	367	471	379	595	842	5
multicellular	474	367	520	379	595	842	5
filamen-	523	367	553	379	595	842	5
tous	348	378	363	390	595	842	5
biofilms.	365	378	397	390	595	842	5
J.	400	378	405	390	595	842	5
Antimicr.	407	378	441	390	595	842	5
Chemother.	444	378	485	390	595	842	5
62:	488	378	499	390	595	842	5
1281-1284.	501	378	543	390	595	842	5
Mowat	313	389	339	401	595	842	5
E.,	340	389	350	401	595	842	5
C.	352	389	360	401	595	842	5
Williams,	361	389	396	401	595	842	5
B.	398	389	406	401	595	842	5
Jones,	408	389	430	401	595	842	5
S.	431	389	438	401	595	842	5
Mcchlery	440	389	474	401	595	842	5
&	476	389	483	401	595	842	5
G.	485	389	493	401	595	842	5
Ramage.	495	389	526	401	595	842	5
2008b.	528	389	553	401	595	842	5
The	348	399	362	411	595	842	5
characteristics	366	399	417	411	595	842	5
of	421	399	428	411	595	842	5
Aspergillus	431	399	472	411	595	842	5
fumigatus	476	399	512	411	595	842	5
mycetoma	515	399	553	411	595	842	5
development:	348	410	398	422	595	842	5
is	402	410	408	422	595	842	5
this	412	410	425	422	595	842	5
a	429	410	433	422	595	842	5
biofilm?	436	410	467	422	595	842	5
Medical	470	410	501	422	595	842	5
Mycol.	504	410	530	422	595	842	5
DOI:	534	410	553	422	595	842	5
10.1080/13693780802238834.	348	421	459	433	595	842	5
Skowronek	313	432	354	444	595	842	5
M.	357	432	367	444	595	842	5
&	371	432	378	444	595	842	5
J.	381	432	386	444	595	842	5
Fiedurek.	389	432	424	444	595	842	5
2006.	427	432	447	444	595	842	5
Inulinase	450	432	483	444	595	842	5
biosynthesis	486	432	530	444	595	842	5
using	533	432	553	444	595	842	5
immobilized	348	443	395	455	595	842	5
mycelium	399	443	436	455	595	842	5
of	440	443	448	455	595	842	5
Aspergillus	451	443	494	455	595	842	5
niger.	498	443	519	455	595	842	5
Enzyme	523	443	553	455	595	842	5
Microb.	348	453	377	465	595	842	5
Technol.	379	453	410	465	595	842	5
38:	412	453	424	465	595	842	5
162-167.	426	453	458	465	595	842	5
Stotz	313	464	332	476	595	842	5
K.C.,	334	464	353	476	595	842	5
A.	354	464	363	476	595	842	5
Bostanci	365	464	396	476	595	842	5
&	398	464	405	476	595	842	5
P.E.	407	464	421	476	595	842	5
Griffiths.	423	464	456	476	595	842	5
2006.	458	464	478	476	595	842	5
Tracking	480	464	512	476	595	842	5
the	514	464	525	476	595	842	5
Shift	526	464	544	476	595	842	5
to	546	464	553	476	595	842	5
‘Postgenomics'	348	475	404	487	595	842	5
Community	406	475	449	487	595	842	5
Genetics	451	475	483	487	595	842	5
2006:190–196.	485	475	539	487	595	842	5
Viniegra-González	313	486	381	498	595	842	5
G.,	384	486	395	498	595	842	5
E.	397	486	405	498	595	842	5
Favela-Torres,	408	486	460	498	595	842	5
C.N.	463	486	480	498	595	842	5
Aguilar	482	486	509	498	595	842	5
et	512	486	518	498	595	842	5
al.	521	486	530	498	595	842	5
2003.	533	486	553	498	595	842	5
Advantages	348	497	391	509	595	842	5
of	394	497	402	509	595	842	5
fungal	405	497	428	509	595	842	5
enzyme	431	497	459	509	595	842	5
production	463	497	502	509	595	842	5
in	505	497	512	509	595	842	5
solid	515	497	533	509	595	842	5
state	536	497	553	509	595	842	5
over	348	507	364	519	595	842	5
liquid	367	507	388	519	595	842	5
fermentation	392	507	438	519	595	842	5
systems.	441	507	471	519	595	842	5
Biochem.	475	507	509	519	595	842	5
Eng.	512	507	529	519	595	842	5
J.	532	507	538	519	595	842	5
13:	541	507	553	519	595	842	5
157-167.	348	518	380	530	595	842	5
Villena,	313	529	341	541	595	842	5
G.K.	345	529	362	541	595	842	5
&	366	529	373	541	595	842	5
M.	376	529	386	541	595	842	5
Gutiérrez-Correa.	390	529	453	541	595	842	5
2003.	457	529	477	541	595	842	5
Biopelículas	480	529	525	541	595	842	5
de	528	529	537	541	595	842	5
As-	540	529	553	541	595	842	5
pergillus	348	540	380	552	595	842	5
niger	382	540	401	552	595	842	5
para	406	540	421	552	595	842	5
la	424	540	430	552	595	842	5
producción	433	540	474	552	595	842	5
de	476	540	485	552	595	842	5
celulasas:	487	540	522	552	595	842	5
algunos	525	540	553	552	595	842	5
aspectos	348	551	379	563	595	842	5
estructurales	381	551	427	563	595	842	5
y	429	551	434	563	595	842	5
fisiológicos.	436	551	480	563	595	842	5
Rev.	483	551	499	563	595	842	5
peru.	502	551	520	563	595	842	5
biol.	522	551	539	563	595	842	5
10:	541	551	553	563	595	842	5
78-87.	348	561	371	573	595	842	5
Villena	313	572	339	584	595	842	5
G.K.	342	572	359	584	595	842	5
&	361	572	368	584	595	842	5
M.Gutiérrez-Correa.	371	572	445	584	595	842	5
2006.	447	572	467	584	595	842	5
Production	470	572	509	584	595	842	5
of	511	572	519	584	595	842	5
cellulase	521	572	553	584	595	842	5
by	348	583	357	595	595	842	5
Aspergillus	358	583	399	595	595	842	5
niger	400	583	418	595	595	842	5
biofilms	420	583	449	595	595	842	5
developed	451	583	487	595	595	842	5
on	488	583	497	595	595	842	5
polyester	499	583	531	595	595	842	5
cloth.	533	583	553	595	595	842	5
Lett.	348	594	365	606	595	842	5
Appl.	367	594	387	606	595	842	5
Microbiol.	389	594	427	606	595	842	5
43:	432	594	443	606	595	842	5
262-268.	446	594	478	606	595	842	5
Villena	313	605	339	617	595	842	5
G.K.	341	605	358	617	595	842	5
&	359	605	366	617	595	842	5
M.	368	605	378	617	595	842	5
Gutiérrez-Correa.	380	605	443	617	595	842	5
2007a.	444	605	468	617	595	842	5
Morphological	470	605	523	617	595	842	5
patterns	525	605	553	617	595	842	5
of	348	615	356	627	595	842	5
Aspergillus	358	615	399	627	595	842	5
niger	401	615	420	627	595	842	5
biofilms	422	615	452	627	595	842	5
and	454	615	467	627	595	842	5
pellets	469	615	493	627	595	842	5
related	495	615	520	627	595	842	5
to	522	615	529	627	595	842	5
ligno-	531	615	553	627	595	842	5
cellulolytic	348	626	389	638	595	842	5
enzyme	391	626	419	638	595	842	5
productivities.	421	626	472	638	595	842	5
Lett.	474	626	491	638	595	842	5
Appl.	492	626	513	638	595	842	5
Microbiol.	515	626	553	638	595	842	5
45:	348	637	360	649	595	842	5
231-237.	362	637	394	649	595	842	5
Villena	313	648	339	660	595	842	5
G.K.	341	648	358	660	595	842	5
&	360	648	367	660	595	842	5
M.	369	648	379	660	595	842	5
Gutiérrez-Correa.	381	648	445	660	595	842	5
2007b.	446	648	471	660	595	842	5
Production	473	648	512	660	595	842	5
of	514	648	522	660	595	842	5
lignoce-	523	648	553	660	595	842	5
llulolytic	348	659	380	671	595	842	5
enzymes	382	659	413	671	595	842	5
by	414	659	423	671	595	842	5
Aspergillus	424	659	465	671	595	842	5
niger	466	659	484	671	595	842	5
biofilms	486	659	515	671	595	842	5
at	516	659	523	671	595	842	5
variable	524	659	553	671	595	842	5
water	348	669	368	681	595	842	5
activities.	370	669	404	681	595	842	5
Electr.	405	669	428	681	595	842	5
J.	430	669	435	681	595	842	5
Biotechnol.	437	669	478	681	595	842	5
Vol.10	479	669	503	681	595	842	5
No.1,	504	669	524	681	595	842	5
Issue	526	669	544	681	595	842	5
of	545	669	553	681	595	842	5
January	348	680	376	692	595	842	5
15.	378	680	390	692	595	842	5
DOI:	392	680	410	692	595	842	5
10.2225/vol10-issue5-fulltext-2.	413	680	529	692	595	842	5
Ward	313	691	333	703	595	842	5
O.P.,	335	691	353	703	595	842	5
W.M.	355	691	375	703	595	842	5
Qin,	378	691	394	703	595	842	5
J.	397	691	402	703	595	842	5
Dhanjoon,	405	691	443	703	595	842	5
J.	446	691	451	703	595	842	5
Ye	454	691	463	703	595	842	5
&	466	691	473	703	595	842	5
A.	475	691	484	703	595	842	5
Singh.	487	691	510	703	595	842	5
2006.	513	691	533	703	595	842	5
Phy-	536	691	553	703	595	842	5
siology	348	702	375	714	595	842	5
and	379	702	392	714	595	842	5
Biotechnology	396	702	450	714	595	842	5
of	453	702	461	714	595	842	5
Aspergillus.	464	702	508	714	595	842	5
Adv.	512	702	529	714	595	842	5
Appl.	532	702	553	714	595	842	5
Microbiol.	348	713	386	725	595	842	5
58:	389	713	400	725	595	842	5
1-75.	402	713	421	725	595	842	5
Witte	313	723	333	735	595	842	5
K.	337	723	345	735	595	842	5
&	349	723	356	735	595	842	5
A.	359	723	368	735	595	842	5
Wartenberg.	371	723	415	735	595	842	5
2004.	419	723	439	735	595	842	5
Purification	443	723	485	735	595	842	5
and	489	723	502	735	595	842	5
properties	505	723	542	735	595	842	5
of	545	723	553	735	595	842	5
two	348	734	362	746	595	842	5
β-glucosidases	364	734	417	746	595	842	5
isolated	420	734	448	746	595	842	5
from	450	734	468	746	595	842	5
Aspergillus	470	734	511	746	595	842	5
niger.	514	734	534	746	595	842	5
Acta	536	734	553	746	595	842	5
Biotechnologica	348	745	407	757	595	842	5
9:	409	745	416	757	595	842	5
179-190.	419	745	451	757	595	842	5
Wimpenny	313	756	353	768	595	842	5
J.,	357	756	365	768	595	842	5
W.	368	756	378	768	595	842	5
Manz	381	756	402	768	595	842	5
&	406	756	413	768	595	842	5
U.	416	756	425	768	595	842	5
Szewzyk.	428	756	463	768	595	842	5
2000.	467	756	487	768	595	842	5
Heterogeneity	491	756	542	768	595	842	5
in	546	756	553	768	595	842	5
biofilms.	348	767	380	779	595	842	5
FEMS	382	767	406	779	595	842	5
Microbiol.	408	767	446	779	595	842	5
Lett.	449	767	465	779	595	842	5
24:	468	767	479	779	595	842	5
661-671.	481	767	514	779	595	842	5
101	535	800	552	814	595	842	5
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	565	302	577	544	595	842	5
Beauvais	57	54	89	66	595	842	5
A.,	90	54	101	66	595	842	5
C.	103	54	111	66	595	842	5
Schmidt,	113	54	145	66	595	842	5
S.	146	54	153	66	595	842	5
Guadagnini,	155	54	199	66	595	842	5
et	200	54	207	66	595	842	5
al.	208	54	217	66	595	842	5
2007.	218	54	238	66	595	842	5
An	239	54	250	66	595	842	5
extracellular	252	54	296	66	595	842	5
matrix	92	65	115	77	595	842	5
glues	117	65	136	77	595	842	5
together	137	65	167	77	595	842	5
the	169	65	180	77	595	842	5
aerial-grown	181	65	227	77	595	842	5
hyphae	229	65	255	77	595	842	5
of	256	65	264	77	595	842	5
Aspergi-	265	65	296	77	595	842	5
llus	92	75	105	87	595	842	5
fumigatus.	107	75	145	87	595	842	5
Cell	147	75	162	87	595	842	5
Microbiol	165	75	201	87	595	842	5
9:	203	75	210	87	595	842	5
1588–1600.	212	75	255	87	595	842	5
Bhat	57	86	74	98	595	842	5
M.K.	76	86	95	98	595	842	5
2000.	98	86	118	98	595	842	5
Cellulases	120	86	157	98	595	842	5
and	160	86	173	98	595	842	5
other	175	86	194	98	595	842	5
related	196	86	221	98	595	842	5
enzymes	223	86	255	98	595	842	5
in	257	86	264	98	595	842	5
biotech-	267	86	296	98	595	842	5
nology.	92	97	118	109	595	842	5
Biotechnol.	121	97	162	109	595	842	5
Adv.	164	97	181	109	595	842	5
18:	184	97	195	109	595	842	5
355-383.	197	97	230	109	595	842	5
Birch	57	108	77	120	595	842	5
P.R.J.,	80	108	102	120	595	842	5
P.F.G.	108	108	129	120	595	842	5
Sims	132	108	150	120	595	842	5
&	153	108	160	120	595	842	5
P.	163	108	170	120	595	842	5
Broda.	172	108	197	120	595	842	5
1995.	200	108	220	120	595	842	5
Substrate-dependent	223	108	296	120	595	842	5
differential	92	119	132	131	595	842	5
splicing	133	119	162	131	595	842	5
of	164	119	171	131	595	842	5
introns	173	119	198	131	595	842	5
in	200	119	207	131	595	842	5
the	209	119	220	131	595	842	5
regions	222	119	248	131	595	842	5
encoding	250	119	283	131	595	842	5
the	285	119	296	131	595	842	5
cellulose	92	129	124	141	595	842	5
binding	125	129	153	141	595	842	5
domains	155	129	185	141	595	842	5
of	187	129	194	141	595	842	5
two	196	129	210	141	595	842	5
exocellobiohydrolase	212	129	288	141	595	842	5
I-	290	129	296	141	595	842	5
like	92	140	105	152	595	842	5
genes	106	140	126	152	595	842	5
in	128	140	135	152	595	842	5
Phanerochaete	136	140	187	152	595	842	5
chrysosporium.	189	140	243	152	595	842	5
Appl.	244	140	264	152	595	842	5
Environ.	266	140	296	152	595	842	5
Microbiol.	92	151	130	163	595	842	5
61:	132	151	144	163	595	842	5
3741–3744.	146	151	189	163	595	842	5
Caddick	57	162	87	174	595	842	5
M.K.,	89	162	110	174	595	842	5
M.G.	114	162	133	174	595	842	5
Jones,	134	162	157	174	595	842	5
J.M.	158	162	175	174	595	842	5
van	176	162	189	174	595	842	5
Tonder,	191	162	218	174	595	842	5
et	220	162	227	174	595	842	5
al.	229	162	237	174	595	842	5
2006.	239	162	259	174	595	842	5
Opposing	261	162	296	174	595	842	5
signals	92	173	117	185	595	842	5
differentially	118	173	165	185	595	842	5
regulate	167	173	196	185	595	842	5
transcript	197	173	231	185	595	842	5
stability	233	173	262	185	595	842	5
in	264	173	271	185	595	842	5
Asper-	272	173	296	185	595	842	5
gillus	92	183	112	195	595	842	5
nidulans.	114	183	147	195	595	842	5
Mol.Microbiol.	149	183	204	195	595	842	5
62:	207	183	218	195	595	842	5
509–519.	220	183	254	195	595	842	5
Carpita	57	194	83	206	595	842	5
N.C.	87	194	104	206	595	842	5
1996.	107	194	127	206	595	842	5
Structure	131	194	164	206	595	842	5
and	167	194	180	206	595	842	5
biogenesis	183	194	221	206	595	842	5
of	225	194	232	206	595	842	5
the	236	194	247	206	595	842	5
cell	250	194	263	206	595	842	5
walls	266	194	285	206	595	842	5
of	289	194	296	206	595	842	5
grasses.	92	205	120	217	595	842	5
Annu.	122	205	145	217	595	842	5
Rev.	147	205	164	217	595	842	5
Plant	166	205	185	217	595	842	5
Physiol.	188	205	217	217	595	842	5
Plant	220	205	238	217	595	842	5
Mol.	241	205	258	217	595	842	5
Biol.	261	205	279	217	595	842	5
47:	285	205	296	217	595	842	5
445-76.	92	216	119	228	595	842	5
Chandrasekar,	57	227	107	239	595	842	5
P.H.	109	227	124	239	595	842	5
&	125	227	132	239	595	842	5
E.K.	134	227	150	239	595	842	5
Manavathu.	151	227	194	239	595	842	5
2008.	195	227	215	239	595	842	5
Do	217	227	227	239	595	842	5
Aspergillus	229	227	269	239	595	842	5
species	271	227	296	239	595	842	5
produce	92	237	121	249	595	842	5
biofilm?	123	237	153	249	595	842	5
Future	155	237	179	249	595	842	5
Microbiol.	181	237	219	249	595	842	5
3:	221	237	228	249	595	842	5
19-21.	231	237	254	249	595	842	5
Costanzo	57	248	90	260	595	842	5
S.,	92	248	102	260	595	842	5
M.D.	103	248	122	260	595	842	5
Ospina-Giraldo,	124	248	182	260	595	842	5
K.L.	184	248	201	260	595	842	5
Deahl,	203	248	226	260	595	842	5
C.J.	228	248	242	260	595	842	5
Baker	246	248	267	260	595	842	5
&	269	248	276	260	595	842	5
R.W.	278	248	296	260	595	842	5
Jones.	92	259	114	271	595	842	5
2006.	116	259	136	271	595	842	5
Gene	137	259	156	271	595	842	5
duplication	158	259	199	271	595	842	5
event	200	259	220	271	595	842	5
in	221	259	228	271	595	842	5
family	230	259	253	271	595	842	5
12	255	259	264	271	595	842	5
glycosyl	266	259	296	271	595	842	5
hydrolase	92	270	127	282	595	842	5
from	130	270	148	282	595	842	5
Phytophthora	151	270	200	282	595	842	5
spp.	204	270	219	282	595	842	5
Fungal	222	270	247	282	595	842	5
Genet.	251	270	275	282	595	842	5
Biol.	278	270	296	282	595	842	5
43:	92	281	103	293	595	842	5
707–714.	105	281	139	293	595	842	5
Dai,	57	291	72	303	595	842	5
Z.,	74	291	84	303	595	842	5
M.	86	291	96	303	595	842	5
Xingxue,	98	291	131	303	595	842	5
J.K.	133	291	148	303	595	842	5
Magnuson	150	291	188	303	595	842	5
&	190	291	197	303	595	842	5
L.	199	291	206	303	595	842	5
Lasure.	208	291	235	303	595	842	5
2004.	237	291	257	303	595	842	5
Identifica-	259	291	296	303	595	842	5
tion	92	302	106	314	595	842	5
of	108	302	115	314	595	842	5
Genes	117	302	139	314	595	842	5
Associated	141	302	180	314	595	842	5
with	182	302	198	314	595	842	5
Morphology	200	302	245	314	595	842	5
in	247	302	254	314	595	842	5
Aspergillus	255	302	296	314	595	842	5
niger	92	313	110	325	595	842	5
by	114	313	123	325	595	842	5
Using	126	313	148	325	595	842	5
Suppression	151	313	195	325	595	842	5
Subtractive	199	313	240	325	595	842	5
Hybridization.	244	313	296	325	595	842	5
Appl.	92	324	112	336	595	842	5
Environ.	114	324	145	336	595	842	5
Microbiol.	148	324	186	336	595	842	5
70:	188	324	200	336	595	842	5
2474-2485.	202	324	243	336	595	842	5
Damveld	57	335	89	347	595	842	5
R.A.,	91	335	110	347	595	842	5
P.A.	112	335	126	347	595	842	5
vanKuyk,	128	335	163	347	595	842	5
M.	164	335	175	347	595	842	5
Arentshorst,	176	335	219	347	595	842	5
F.M.	221	335	238	347	595	842	5
Klis,	239	335	256	347	595	842	5
C.A.M.J.J.	258	335	296	347	595	842	5
van	92	345	105	357	595	842	5
den	107	345	120	357	595	842	5
Hondel	121	345	148	357	595	842	5
&	150	345	157	357	595	842	5
A.F.J.	158	345	179	357	595	842	5
Ram.	181	345	200	357	595	842	5
2005.	202	345	222	357	595	842	5
Expression	224	345	264	357	595	842	5
of	266	345	274	357	595	842	5
agsA,	275	345	296	357	595	842	5
one	92	356	105	368	595	842	5
of	108	356	116	368	595	842	5
the	119	356	130	368	595	842	5
1,3-β-D-glucan	134	356	190	368	595	842	5
synthase-encoding	194	356	261	368	595	842	5
genes	265	356	286	368	595	842	5
in	289	356	296	368	595	842	5
Aspergillus	92	367	133	379	595	842	5
niger,	134	367	154	379	595	842	5
is	156	367	162	379	595	842	5
induced	163	367	192	379	595	842	5
in	193	367	200	379	595	842	5
response	202	367	233	379	595	842	5
to	234	367	241	379	595	842	5
cell	243	367	256	379	595	842	5
wall	257	367	273	379	595	842	5
stress.	274	367	296	379	595	842	5
Fungal	92	378	117	390	595	842	5
Genet.	119	378	143	390	595	842	5
Biol.	145	378	163	390	595	842	5
42:	165	378	176	390	595	842	5
165–177.	179	378	212	390	595	842	5
Denison	57	389	87	401	595	842	5
S.H.	90	389	106	401	595	842	5
2000.	108	389	129	401	595	842	5
pH	132	389	143	401	595	842	5
Regulation	146	389	185	401	595	842	5
of	188	389	195	401	595	842	5
Gene	198	389	217	401	595	842	5
Expression	220	389	260	401	595	842	5
in	263	389	270	401	595	842	5
Fungi.	273	389	296	401	595	842	5
Fungal	92	399	117	411	595	842	5
Genet.	119	399	143	411	595	842	5
Biol.	145	399	163	411	595	842	5
29:	165	399	176	411	595	842	5
61-71.	179	399	202	411	595	842	5
de	57	410	65	422	595	842	5
Vries	68	410	87	422	595	842	5
R.P.	90	410	104	422	595	842	5
&	107	410	114	422	595	842	5
J.	117	410	122	422	595	842	5
Visser.	125	410	149	422	595	842	5
2001.	152	410	172	422	595	842	5
Aspergillus	175	410	216	422	595	842	5
Enzymes	219	410	252	422	595	842	5
Involved	254	410	286	422	595	842	5
in	289	410	296	422	595	842	5
Degradation	92	421	135	433	595	842	5
of	137	421	144	433	595	842	5
Plant	145	421	164	433	595	842	5
Cell	165	421	180	433	595	842	5
Wall	181	421	197	433	595	842	5
Polysaccharides.	199	421	257	433	595	842	5
Microbiol.	259	421	296	433	595	842	5
Mol.	92	432	109	444	595	842	5
Biol.	111	432	129	444	595	842	5
Rev.	131	432	147	444	595	842	5
65:	150	432	161	444	595	842	5
497–522.	163	432	197	444	595	842	5
Donzelli	57	443	88	455	595	842	5
B.G.G.	90	443	115	455	595	842	5
&	117	443	124	455	595	842	5
G.E.	126	443	143	455	595	842	5
Harman.	145	443	176	455	595	842	5
2001.	178	443	198	455	595	842	5
Interaction	200	443	239	455	595	842	5
of	241	443	249	455	595	842	5
Ammonium,	250	443	296	455	595	842	5
Glucose,	92	453	123	465	595	842	5
and	124	453	137	465	595	842	5
Chitin	139	453	161	465	595	842	5
Regulates	162	453	197	465	595	842	5
the	199	453	209	465	595	842	5
Expression	211	453	250	465	595	842	5
of	252	453	259	465	595	842	5
Cell	261	453	275	465	595	842	5
Wall-	277	453	296	465	595	842	5
Degrading	92	464	130	476	595	842	5
Enzymes	132	464	165	476	595	842	5
in	167	464	174	476	595	842	5
Trichoderma	176	464	222	476	595	842	5
atroviride	224	464	259	476	595	842	5
Strain	261	464	282	476	595	842	5
P1.	284	464	296	476	595	842	5
Appl.	92	475	112	487	595	842	5
Environ.	114	475	145	487	595	842	5
Microbiol.	148	475	186	487	595	842	5
67:	188	475	200	487	595	842	5
5643–5647.	202	475	245	487	595	842	5
Dueñas	57	486	84	498	595	842	5
R.,	86	486	97	498	595	842	5
R.P.	99	486	113	498	595	842	5
Tengerdy	116	486	150	498	595	842	5
&	152	486	159	498	595	842	5
M.	161	486	172	498	595	842	5
Gutierrez-Correa.	174	486	238	498	595	842	5
1995.	240	486	260	498	595	842	5
Cellulase	263	486	296	498	595	842	5
production	92	497	131	509	595	842	5
by	132	497	141	509	595	842	5
mixed	143	497	165	509	595	842	5
fungi	167	497	186	509	595	842	5
in	188	497	195	509	595	842	5
solid-substrate	196	497	249	509	595	842	5
fermentation	250	497	296	509	595	842	5
of	92	507	99	519	595	842	5
bagasse.	101	507	132	519	595	842	5
World	134	507	156	519	595	842	5
J.	158	507	164	519	595	842	5
Microbiol.	166	507	204	519	595	842	5
Biotechnol.	207	507	248	519	595	842	5
11:	251	507	262	519	595	842	5
333-337.	264	507	296	519	595	842	5
Fry	57	518	69	530	595	842	5
S.C.	72	518	87	530	595	842	5
2004.	90	518	110	530	595	842	5
Primary	113	518	142	530	595	842	5
cell	144	518	157	530	595	842	5
wall	160	518	175	530	595	842	5
metabolism:	178	518	222	530	595	842	5
tracking	225	518	255	530	595	842	5
the	257	518	268	530	595	842	5
careers	271	518	296	530	595	842	5
of	92	529	99	541	595	842	5
wall	102	529	118	541	595	842	5
polymers	121	529	155	541	595	842	5
in	158	529	165	541	595	842	5
living	168	529	189	541	595	842	5
plant	192	529	210	541	595	842	5
cells.	213	529	232	541	595	842	5
New	235	529	252	541	595	842	5
Phytologist	255	529	296	541	595	842	5
161:	92	540	108	552	595	842	5
641–675.	110	540	144	552	595	842	5
Galagan	57	551	86	563	595	842	5
J.E.,	88	551	104	563	595	842	5
M.R.	105	551	124	563	595	842	5
Henn,	125	551	147	563	595	842	5
L.J.	148	551	162	563	595	842	5
Ma,	165	551	179	563	595	842	5
C.A.	182	551	199	563	595	842	5
Cuomo	201	551	227	563	595	842	5
&	229	551	236	563	595	842	5
B.	237	551	245	563	595	842	5
Bruce.	247	551	271	563	595	842	5
2005a.	272	551	296	563	595	842	5
Genomics	92	561	128	573	595	842	5
of	130	561	137	573	595	842	5
the	139	561	150	573	595	842	5
fungal	152	561	175	573	595	842	5
kingdom:	176	561	211	573	595	842	5
Insights	212	561	241	573	595	842	5
into	243	561	257	573	595	842	5
eukaryotic	258	561	296	573	595	842	5
biology.	92	572	121	584	595	842	5
Genome	123	572	154	584	595	842	5
Res.	156	572	172	584	595	842	5
15:	174	572	185	584	595	842	5
1620-1631.	188	572	229	584	595	842	5
Galbe	57	583	78	595	595	842	5
M.	80	583	90	595	595	842	5
&	92	583	99	595	595	842	5
G.	101	583	110	595	595	842	5
Zacchi.	112	583	139	595	595	842	5
2002.	141	583	161	595	595	842	5
A	162	583	169	595	595	842	5
review	170	583	195	595	595	842	5
of	197	583	204	595	595	842	5
the	206	583	217	595	595	842	5
production	219	583	258	595	595	842	5
of	260	583	268	595	595	842	5
ethanol	270	583	296	595	595	842	5
from	92	594	109	606	595	842	5
softwood.	113	594	149	606	595	842	5
Appl.	152	594	173	606	595	842	5
Microbiol.	176	594	215	606	595	842	5
Biotechnol.	218	594	261	606	595	842	5
59:	264	594	276	606	595	842	5
618-	279	594	296	606	595	842	5
628.	92	605	107	617	595	842	5
Ghigo	57	615	79	627	595	842	5
J.M.	81	615	97	627	595	842	5
2003.	98	615	119	627	595	842	5
Are	120	615	133	627	595	842	5
there	135	615	153	627	595	842	5
biofilm-specific	154	615	211	627	595	842	5
physiological	212	615	261	627	595	842	5
pathways	262	615	296	627	595	842	5
beyond	92	626	118	638	595	842	5
a	120	626	124	638	595	842	5
reasonable	127	626	165	638	595	842	5
doubts?	167	626	195	638	595	842	5
Res.	198	626	213	638	595	842	5
Microbiol.	216	626	254	638	595	842	5
154:	256	626	272	638	595	842	5
1-8.	274	626	289	638	595	842	5
Gielkens	57	637	89	649	595	842	5
M.M.C.,	92	637	123	649	595	842	5
E.	125	637	133	649	595	842	5
Dekkers,	136	637	168	649	595	842	5
J.	171	637	177	649	595	842	5
Visser,	180	637	204	649	595	842	5
&	207	637	214	649	595	842	5
L.H.	217	637	233	649	595	842	5
de	236	637	245	649	595	842	5
Graaff.	248	637	273	649	595	842	5
1999.	276	637	296	649	595	842	5
Two	92	648	108	660	595	842	5
cellobiohydrolase-encoding	110	648	210	660	595	842	5
genes	212	648	233	660	595	842	5
from	235	648	253	660	595	842	5
Aspergillus	255	648	296	660	595	842	5
niger	92	659	110	671	595	842	5
require	112	659	138	671	595	842	5
D-xylose	139	659	172	671	595	842	5
and	174	659	187	671	595	842	5
the	189	659	200	671	595	842	5
xylanolytic	202	659	242	671	595	842	5
transcriptional	244	659	296	671	595	842	5
activator	92	669	123	681	595	842	5
XlnR	125	669	144	681	595	842	5
for	146	669	156	681	595	842	5
their	158	669	174	681	595	842	5
expression.	176	669	216	681	595	842	5
Appl.	217	669	237	681	595	842	5
Environ.	239	669	270	681	595	842	5
Micro-	271	669	296	681	595	842	5
biol.	92	680	108	692	595	842	5
65:	110	680	122	692	595	842	5
4340–4345.	124	680	167	692	595	842	5
Gutiérrez-Correa,	57	691	120	703	595	842	5
M.	123	691	133	703	595	842	5
&	136	691	143	703	595	842	5
G.K.	145	691	163	703	595	842	5
Villena.	165	691	193	703	595	842	5
2003.	196	691	216	703	595	842	5
Surface	219	691	246	703	595	842	5
adhesion	249	691	281	703	595	842	5
fer-	283	691	296	703	595	842	5
mentation:	92	702	130	714	595	842	5
a	132	702	136	714	595	842	5
new	139	702	154	714	595	842	5
fermentation	156	702	202	714	595	842	5
category.	204	702	237	714	595	842	5
Rev.	239	702	255	714	595	842	5
peru.	260	702	278	714	595	842	5
biol.	280	702	296	714	595	842	5
10:	92	713	103	725	595	842	5
113-124.	105	713	137	725	595	842	5
Hasper	57	723	82	735	595	842	5
A.A.,	85	723	105	735	595	842	5
E.	108	723	116	735	595	842	5
Dekkers,	119	723	151	735	595	842	5
M.	155	723	165	735	595	842	5
van	168	723	181	735	595	842	5
Mil,	184	723	200	735	595	842	5
P.J.I.	203	723	220	735	595	842	5
van	223	723	236	735	595	842	5
de	240	723	248	735	595	842	5
Vondervoort	251	723	296	735	595	842	5
&	92	734	99	746	595	842	5
L.	101	734	109	746	595	842	5
de	111	734	120	746	595	842	5
Graaff.	122	734	148	746	595	842	5
2002.	150	734	170	746	595	842	5
EglC,	173	734	194	746	595	842	5
a	196	734	200	746	595	842	5
New	202	734	219	746	595	842	5
Endoglucanase	222	734	276	746	595	842	5
from	279	734	296	746	595	842	5
Aspergillus	92	745	133	757	595	842	5
niger	134	745	153	757	595	842	5
with	154	745	170	757	595	842	5
major	172	745	193	757	595	842	5
activity	194	745	221	757	595	842	5
towards	223	745	251	757	595	842	5
Xyloglucan.	252	745	296	757	595	842	5
Appl.	92	756	112	768	595	842	5
Environ.	114	756	145	768	595	842	5
Microbiol.	148	756	186	768	595	842	5
68:	188	756	200	768	595	842	5
1556–1560.	202	756	245	768	595	842	5
Villena	42	31	71	42	595	842	6
et	74	31	82	42	595	842	6
al.	84	31	94	42	595	842	6
http://sisbib.unmsm.edu.pe/BVRevistas/biologia/biologiaNEW.htm	19	299	30	541	595	842	6
Wu	42	54	55	66	595	842	6
J.,	57	54	65	66	595	842	6
Y.-Z.	67	54	86	66	595	842	6
Xiao	88	54	106	66	595	842	6
&	108	54	115	66	595	842	6
H.-Q.	117	54	138	66	595	842	6
Yu.	140	54	152	66	595	842	6
2005.	154	54	174	66	595	842	6
Degradation	177	54	221	66	595	842	6
of	224	54	231	66	595	842	6
lignin	233	54	254	66	595	842	6
in	257	54	264	66	595	842	6
pulp	266	54	282	66	595	842	6
mill	78	65	92	77	595	842	6
wastewaters	94	65	137	77	595	842	6
by	139	65	148	77	595	842	6
white-rot	150	65	182	77	595	842	6
fungi	184	65	203	77	595	842	6
on	205	65	213	77	595	842	6
biofilm.	215	65	243	77	595	842	6
Bioresour.	245	65	282	77	595	842	6
Technol.	78	75	109	87	595	842	6
96:	111	75	122	87	595	842	6
1357–1363.	125	75	167	87	595	842	6
Yadav	42	86	65	98	595	842	6
J.S.,	68	86	83	98	595	842	6
M.B.	86	86	104	98	595	842	6
Soellner,	107	86	139	98	595	842	6
J.C.	141	86	155	98	595	842	6
Loper	158	86	180	98	595	842	6
&	182	86	189	98	595	842	6
P.K.	192	86	207	98	595	842	6
Mishra.	210	86	238	98	595	842	6
2003.	243	86	263	98	595	842	6
Tan-	266	86	282	98	595	842	6
dem	78	97	93	109	595	842	6
cytochrome	96	97	138	109	595	842	6
P450	141	97	159	109	595	842	6
monooxygenase	162	97	220	109	595	842	6
genes	223	97	243	109	595	842	6
and	246	97	259	109	595	842	6
splice	261	97	282	109	595	842	6
variants	78	108	106	120	595	842	6
in	109	108	116	120	595	842	6
the	119	108	130	120	595	842	6
white	133	108	153	120	595	842	6
rot	156	108	166	120	595	842	6
fungus	169	108	193	120	595	842	6
Phanerochaete	196	108	249	120	595	842	6
chrysos-	252	108	282	120	595	842	6
porium:	78	119	107	131	595	842	6
cloning,	110	119	140	131	595	842	6
sequence	144	119	177	131	595	842	6
analysis,	181	119	213	131	595	842	6
and	217	119	230	131	595	842	6
regulation	233	119	271	131	595	842	6
of	274	119	282	131	595	842	6
differential	78	129	117	141	595	842	6
expression.	120	129	160	141	595	842	6
Fungal	163	129	188	141	595	842	6
Genet.	190	129	214	141	595	842	6
Biol.	216	129	234	141	595	842	6
38:10–21.	236	129	272	141	595	842	6
Yang	42	140	61	152	595	842	6
X.,	64	140	75	152	595	842	6
B.	77	140	85	152	595	842	6
Wang,	88	140	111	152	595	842	6
F.	113	140	120	152	595	842	6
Cui	122	140	135	152	595	842	6
&	138	140	145	152	595	842	6
T.	147	140	154	152	595	842	6
Tan.	157	140	172	152	595	842	6
2005.	175	140	195	152	595	842	6
Production	197	140	237	152	595	842	6
of	239	140	247	152	595	842	6
lipase	250	140	270	152	595	842	6
by	273	140	282	152	595	842	6
repeated	78	151	108	163	595	842	6
batch	111	151	130	163	595	842	6
fermentation	133	151	179	163	595	842	6
with	181	151	197	163	595	842	6
immobilized	200	151	245	163	595	842	6
Rhizopus	248	151	282	163	595	842	6
arrhizus.	78	162	109	174	595	842	6
Process	111	162	138	174	595	842	6
Biochem.	141	162	175	174	595	842	6
40:	178	162	189	174	595	842	6
2095-2103.	191	162	233	174	595	842	6
102	42	800	59	814	595	842	6
Rev.	376	798	390	810	595	842	6
peru.	392	798	409	810	595	842	6
biol.	411	798	426	810	595	842	6
15(2):	428	798	450	810	595	842	6
097-	452	798	468	810	595	842	6
102	470	798	484	810	595	842	6
(Febrero	486	798	515	810	595	842	6
2009)	518	798	539	810	595	842	6
