GENERator-v2-prokaryote-1.2b-base model
Important Notice
If you are using GENERator for sequence generation, please ensure that the length of each input sequence is a multiple of 6. This can be achieved by either:
- Padding the sequence on the left with
'A'(left padding); - Truncating the sequence from the left (left truncation).
This requirement arises because GENERator employs a 6-mer tokenizer. If the input sequence length is not a multiple of 6, the tokenizer will append an '<oov>' (out-of-vocabulary) token to the end of the token sequence. This can result in uninformative subsequent generations, such as repeated 'AAAAAA'.
We apologize for any inconvenience this may cause and recommend adhering to the above guidelines to ensure accurate and meaningful generation results.
Abouts
In this repository, we present GENERator-v2, a generative genomic foundation with enhanced performance in prokaryotic domain. More technical details are coming soon...
Python scripts for downstream analysis are available on Github: https://github.com/GenerTeam/GENERator.
How to use
Simple example1: generation
import torch
from transformers import AutoTokenizer, AutoModelForCausalLM
# Load the tokenizer and model.
tokenizer = AutoTokenizer.from_pretrained("GenerTeam/GENERator-v2-prokaryote-1.2b-base", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("GenerTeam/GENERator-v2-prokaryote-1.2b-base")
config = model.config
max_length = config.max_position_embeddings
# Define input sequences.
sequences = [
"ATGAGGTGGCAAGAAATGGGCTAC",
"GAATTCCATGAGGCTATAGAATAATCTAAGAGAAAT"
]
def left_padding(sequence, padding_char='A', multiple=6):
remainder = len(sequence) % multiple
if remainder != 0:
padding_length = multiple - remainder
return padding_char * padding_length + sequence
return sequence
def left_truncation(sequence, multiple=6):
remainder = len(sequence) % multiple
if remainder != 0:
return sequence[remainder:]
return sequence
# Apply left_padding to all sequences
# padded_sequences = [left_padding(seq) for seq in sequences]
# Apply left_truncation to all sequences
truncated_sequences = [left_truncation(seq) for seq in sequences]
# Process the sequences
sequences = [tokenizer.bos_token + sequence for sequence in truncated_sequences]
# Tokenize the sequences
tokenizer.padding_side = "left"
inputs = tokenizer(
sequences,
add_special_tokens=False,
return_tensors="pt",
padding=True,
truncation=True,
max_length=max_length
)
# Generate the sequences
with torch.inference_mode():
outputs = model.generate(**inputs, max_new_tokens=32, temperature=0.00001, top_k=1)
# Decode the generated sequences
decoded_sequences = tokenizer.batch_decode(outputs, skip_special_tokens=True)
# Print the decoded sequences
print(decoded_sequences)
# It is expected to observe non-sense decoded sequences (e.g., 'AAAAAA')
# The input sequences are too short to provide sufficient context.
Simple example2: embedding
import torch
from transformers import AutoTokenizer, AutoModelForCausalLM
# Load the tokenizer and model.
tokenizer = AutoTokenizer.from_pretrained("GENERator-v2-prokaryote-1.2b-base", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("GENERator-v2-prokaryote-1.2b-base")
config = model.config
max_length = config.max_position_embeddings
# Define input sequences.
sequences = [
"ATGAGGTGGCAAGAAATGGGCTAC",
"GAATTCCATGAGGCTATAGAATAATCTAAGAGAAAT"
]
# Tokenize the sequences with add_special_tokens=True to automatically add special tokens,
# such as the BOS EOS token, at the appropriate positions.
tokenizer.padding_side = "right"
inputs = tokenizer(
sequences,
add_special_tokens=True,
return_tensors="pt",
padding=True,
truncation=True,
max_length=max_length
)
# Perform a forward pass through the model to obtain the outputs, including hidden states.
with torch.inference_mode():
outputs = model(**inputs, output_hidden_states=True)
# Retrieve the hidden states from the last layer.
hidden_states = outputs.hidden_states[-1] # Shape: (batch_size, sequence_length, hidden_size)
# Use the attention_mask to determine the index of the last token in each sequence.
# Since add_special_tokens=True is used, the last token is typically the EOS token.
attention_mask = inputs["attention_mask"]
last_token_indices = attention_mask.sum(dim=1) - 1 # Index of the last token for each sequence
# Extract the embedding corresponding to the EOS token for each sequence.
seq_embeddings = []
for i, token_index in enumerate(last_token_indices):
# Fetch the embedding for the last token (EOS token).
seq_embedding = hidden_states[i, token_index, :]
seq_embeddings.append(seq_embedding)
# Stack the embeddings into a tensor with shape (batch_size, hidden_size)
seq_embeddings = torch.stack(seq_embeddings)
print("Sequence Embeddings:", seq_embeddings)
Citation
@misc{wu2025generator,
title={GENERator: A Long-Context Generative Genomic Foundation Model},
author={Wei Wu and Qiuyi Li and Mingyang Li and Kun Fu and Fuli Feng and Jieping Ye and Hui Xiong and Zheng Wang},
year={2025},
eprint={2502.07272},
archivePrefix={arXiv},
primaryClass={cs.CL},
url={https://arxiv.org/abs/2502.07272},
}
- Downloads last month
- 861